##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.0 RC (2025-04-04 r88126)
* using platform: x86_64-apple-darwin20
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Monterey 12.7.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.2.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 46 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  5.6Mb
  sub-directories of 1Mb or more:
    data   2.7Mb
    libs   1.8Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
addRowRanges: no visible global function definition for ‘head’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex: no visible binding for global variable ‘CellBarcode’
plot_demultiplex: no visible binding for global variable ‘Sample’
plot_demultiplex: no visible binding for global variable ‘UMI’
plot_demultiplex: no visible binding for global variable ‘UMI_count’
plot_demultiplex: no visible binding for global variable ‘barcode_rank’
plot_demultiplex: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex: no visible binding for global variable ‘n_reads’
plot_demultiplex: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex: no visible binding for global variable ‘total reads’
plot_demultiplex: no visible binding for global variable ‘demultiplexed
  reads’
plot_demultiplex: no visible binding for global variable ‘single match
  reads’
plot_demultiplex: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex: no visible binding for global variable ‘Type’
plot_demultiplex: no visible binding for global variable ‘Reads’
plot_demultiplex: no visible binding for global variable ‘input’
plot_demultiplex: no visible binding for global variable ‘output’
plot_demultiplex: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count
  bam_index barcode barcode_rank cell_total_reads chisq.test count
  counts_no_ins cumpct demultiplexed reads everything expr filter_res
  head imageX imageY in_tissue input length_bin max_length min_length
  multi-matching reads mutation_index n_reads na.omit name nucleotide
  output p.value pct pos read1_with_adapter read_counts ref
  scale_alpha_continuous scale_colour_gradient single match reads
  starts_with test total total reads total_counts tr_length transcript
  undemultiplexted reads value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("stats", "chisq.test", "na.omit")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  bulk_long_pipeline.Rd: SummarizedExperiment
  sc_long_multisample_pipeline.Rd: SingleCellExperiment
  sc_long_pipeline.Rd: SingleCellExperiment
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
bulk_long_pipeline           24.508  2.702  32.767
sc_long_multisample_pipeline 21.747  3.352  23.064
plot_isoform_reduced_dim     22.010  0.463  22.788
create_se_from_dir           20.102  0.970  18.708
sc_DTU_analysis              10.788  1.349  11.303
plot_isoform_heatmap         10.451  0.637  11.301
create_sce_from_dir           7.890  1.695   9.421
find_isoform                  7.972  0.357   8.596
get_GRangesList               7.399  0.297   7.947
plot_coverage                 7.237  0.347   7.856
sc_long_pipeline              6.173  1.049   5.966
minimap2_align                6.452  0.262   7.116
filter_coverage               4.659  0.268   5.122
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.2.0’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
  unsigned int end;
               ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R version 4.5.0 RC (2025-04-04 r88126) -- "How About a Twenty-Six"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpIz4XNF/fileadda98f2510/config_file_44506.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda5cf2f95e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda3acbc7eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda3acbc7eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpIz4XNF/fileadda5b5052fd/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda5b5052fd/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda5b5052fd/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda5b5052fd/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda7112d0af/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda7112d0af/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpIz4XNF/fileadda2727b45b/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda2727b45b/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda2727b45b/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpIz4XNF/fileadda2727b45b/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda7112d0af/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpIz4XNF/fileadda5ab8a5cc/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 20.620   1.321  22.190