Back to Multiple platform build/check report for BioC 3.20:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2025-01-23 12:05 -0500 (Thu, 23 Jan 2025).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo2Linux (Ubuntu 24.04.1 LTS)x86_644.4.2 (2024-10-31) -- "Pile of Leaves" 4746
palomino8Windows Server 2022 Datacenterx644.4.2 (2024-10-31 ucrt) -- "Pile of Leaves" 4493
merida1macOS 12.7.5 Montereyx86_644.4.2 (2024-10-31) -- "Pile of Leaves" 4517
kjohnson1macOS 13.6.6 Venturaarm644.4.2 (2024-10-31) -- "Pile of Leaves" 4469
taishanLinux (openEuler 24.03 LTS)aarch644.4.2 (2024-10-31) -- "Pile of Leaves" 4394
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 721/2289HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 2.0.2  (landing page)
Changqing Wang
Snapshot Date: 2025-01-20 13:00 -0500 (Mon, 20 Jan 2025)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: RELEASE_3_20
git_last_commit: 8b0f8a9
git_last_commit_date: 2024-12-05 19:57:26 -0500 (Thu, 05 Dec 2024)
nebbiolo2Linux (Ubuntu 24.04.1 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
palomino8Windows Server 2022 Datacenter / x64... NOT SUPPORTED ...
merida1macOS 12.7.5 Monterey / x86_64  OK    OK    OK    OK  UNNEEDED, same version is already published
kjohnson1macOS 13.6.6 Ventura / arm64  OK    OK    OK    OK  UNNEEDED, same version is already published
taishanLinux (openEuler 24.03 LTS) / aarch64  OK    OK    ERROR  


CHECK results for FLAMES on nebbiolo2

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 2.0.2
Command: /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_2.0.2.tar.gz
StartedAt: 2025-01-20 22:06:29 -0500 (Mon, 20 Jan 2025)
EndedAt: 2025-01-20 22:17:25 -0500 (Mon, 20 Jan 2025)
EllapsedTime: 655.8 seconds
RetCode: 0
Status:   OK  
CheckDir: FLAMES.Rcheck
Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_2.0.2.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.2 (2024-10-31)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.2.0-23ubuntu4) 13.2.0
    GNU Fortran (Ubuntu 13.2.0-23ubuntu4) 13.2.0
* running under: Ubuntu 24.04.1 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.0.2’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... NOTE
  installed size is  5.3Mb
  sub-directories of 1Mb or more:
    data   2.7Mb
    libs   1.5Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
create_spe: no visible binding for global variable 'barcode'
filter_coverage: no visible global function definition for
  'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
  'which_label'
find_variants_grange: no visible binding for global variable
  'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
  'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
  reads'
plot_demultiplex: no visible binding for global variable 'single match
  reads'
plot_demultiplex: no visible binding for global variable
  'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
  'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
  'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
  definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
plot_spatial_isoform: no visible global function definition for 'head'
plot_spatial_pie: no visible global function definition for 'head'
plot_spatial_pie: no visible binding for global variable 'imageY'
plot_spatial_pie: no visible binding for global variable 'imageX'
relative_mutation_positions: no visible binding for global variable
  'region'
relative_mutation_positions_single: no visible binding for global
  variable 'type'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
  'cell_total_reads'
Undefined global functions or variables:
  . BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
  allele_count bam_index barcode barcode_rank cell_id cell_total_reads
  cnt count counts_no_ins cumpct demultiplexed reads everything expr
  filter_res gene_id head imageX imageY input label length_bin
  max_length min_length multi-matching reads mutation_index n_reads
  name nucleotide output pct pos read1_with_adapter read_counts ref
  region single match reads starts_with total reads total_counts tr_id
  tr_length transcript type undemultiplexted reads value which_label x
  y
Consider adding
  importFrom("base", "match", "single")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
plot_isoform_reduced_dim     20.717  0.783  21.494
bulk_long_pipeline           18.877  0.773  17.551
create_se_from_dir           17.274  0.498  15.348
sc_long_multisample_pipeline  5.449  5.756   7.084
find_isoform                  8.037  0.628   8.708
get_GRangesList               6.668  0.142   6.858
minimap2_align                6.477  0.126   6.653
plot_coverage                 5.983  0.130   6.146
relative_mutation_positions   5.556  0.224   5.780
create_sce_from_dir           3.354  2.291   4.615
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 5 NOTEs
See
  ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’
for details.


Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.20-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |                 if (blocks.size() >= (int)this->Min_sup_cnt) {
      |                     ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |         if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |              ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |                 (right_counts.size() < (int)this->Min_sup_cnt)) {
      |                  ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |                                 for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                                                 ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |                         for (int i = 0; i < new_exons.size(); ++i) {
      |                                         ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                            ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |                         for (int i = 0; i < exons.size(); i+=2) {
      |                                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:122:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  122 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::string get_umi(const std::string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’:
main-functions/flexiplex.cpp:163:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  163 |     if (seq.length() < umi_start + umi_length) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:187:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  187 |     if (read_to_subpatterns.size() > umi_index + 1) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:295:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  295 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:354:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  354 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  356 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:357:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  357 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:396:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  396 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const std::string&, const std::vector<Barcode>&, std::ostream&)’:
main-functions/flexiplex.cpp:421:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  421 |                << (barcode.flank_end == std::string::npos ? "True" : "False")
      |                    ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’:
main-functions/flexiplex.cpp:453:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  453 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:468:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  468 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  473 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’:
main-functions/flexiplex.cpp:730:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  730 |       for (int t = 0; t < sr_v.size();
      |                       ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:735:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  735 |         for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                         ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:737:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  737 |           for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:739:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  739 |           for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                           ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.20-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.20-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.4.2 (2024-10-31) -- "Pile of Leaves"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d6289540a/config_file_91949.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d209dd953/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d4ff2dd0e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d4ff2dd0e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d47e5e15a/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d47e5e15a/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d47e5e15a/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d47e5e15a/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d2bb73d2a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d2bb73d2a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d796f0f14/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d796f0f14/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d796f0f14/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d796f0f14/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d2bb73d2a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/bbs-3.20-bioc/tmpdir/RtmpZb3SmX/file1672d7a73411/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 20.903   1.321  22.216 

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
annotation_to_fasta1.2800.0431.324
blaze0.3730.0592.131
bulk_long_pipeline18.877 0.77317.551
combine_sce0.8530.1310.984
convolution_filter0.0010.0000.001
create_config0.0050.0000.006
create_sce_from_dir3.3542.2914.615
create_se_from_dir17.274 0.49815.348
cutadapt000
filter_annotation0.6270.1070.734
filter_coverage3.9030.2714.220
find_barcode0.5930.1160.712
find_bin0.0110.0060.016
find_isoform8.0370.6288.708
find_variants3.9100.3704.279
get_GRangesList6.6680.1426.858
get_coverage3.7270.1693.939
minimap2_align6.4770.1266.653
minimap2_realign0.6270.0220.648
parse_gff_tree0.2310.0070.255
plot_coverage5.9830.1306.146
plot_demultiplex1.1200.0351.156
plot_isoform_heatmap3.6860.0443.730
plot_isoform_reduced_dim20.717 0.78321.494
plot_isoforms2.5860.1062.692
quantify_transcript1.7530.0621.866
quantify_transcript_flames1.7140.0161.783
relative_mutation_positions5.5560.2245.780
sc_DTU_analysis2.0492.0702.646
sc_impute_transcript0.6870.0570.744
sc_long_multisample_pipeline5.4495.7567.084
sc_long_pipeline1.4911.7921.777
sc_mutations1.9350.3732.307
weight_transcripts0.0220.0030.025