Back to Multiple platform build/check report for BioC 3.21:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2025-08-21 11:41 -0400 (Thu, 21 Aug 2025).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.3 LTS)x86_644.5.1 (2025-06-13) -- "Great Square Root" 4824
merida1macOS 12.7.5 Montereyx86_644.5.1 RC (2025-06-05 r88288) -- "Great Square Root" 4604
kjohnson1macOS 13.6.6 Venturaarm644.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" 4545
kunpeng2Linux (openEuler 24.03 LTS)aarch64R Under development (unstable) (2025-02-19 r87757) -- "Unsuffered Consequences" 4579
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 735/2341HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 2.2.0  (landing page)
Changqing Wang
Snapshot Date: 2025-08-18 13:40 -0400 (Mon, 18 Aug 2025)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: RELEASE_3_21
git_last_commit: 273f0f6
git_last_commit_date: 2025-04-15 12:35:03 -0400 (Tue, 15 Apr 2025)
nebbiolo1Linux (Ubuntu 24.04.3 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
merida1macOS 12.7.5 Monterey / x86_64  OK    OK    OK    OK  UNNEEDED, same version is already published
kjohnson1macOS 13.6.6 Ventura / arm64  OK    OK    OK    OK  UNNEEDED, same version is already published
kunpeng2Linux (openEuler 24.03 LTS) / aarch64  OK    OK    ERROR  


CHECK results for FLAMES on kjohnson1

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 2.2.0
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz
StartedAt: 2025-08-19 21:31:29 -0400 (Tue, 19 Aug 2025)
EndedAt: 2025-08-19 21:42:27 -0400 (Tue, 19 Aug 2025)
EllapsedTime: 658.4 seconds
RetCode: 0
Status:   OK  
CheckDir: FLAMES.Rcheck
Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.1 Patched (2025-06-14 r88325)
* using platform: aarch64-apple-darwin20
* R was compiled by
    Apple clang version 16.0.0 (clang-1600.0.26.6)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.5
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.2.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 46 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  5.4Mb
  sub-directories of 1Mb or more:
    data   2.7Mb
    libs   1.6Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
addRowRanges: no visible global function definition for ‘head’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex: no visible binding for global variable ‘CellBarcode’
plot_demultiplex: no visible binding for global variable ‘Sample’
plot_demultiplex: no visible binding for global variable ‘UMI’
plot_demultiplex: no visible binding for global variable ‘UMI_count’
plot_demultiplex: no visible binding for global variable ‘barcode_rank’
plot_demultiplex: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex: no visible binding for global variable ‘n_reads’
plot_demultiplex: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex: no visible binding for global variable ‘total reads’
plot_demultiplex: no visible binding for global variable ‘demultiplexed
  reads’
plot_demultiplex: no visible binding for global variable ‘single match
  reads’
plot_demultiplex: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex: no visible binding for global variable ‘Type’
plot_demultiplex: no visible binding for global variable ‘Reads’
plot_demultiplex: no visible binding for global variable ‘input’
plot_demultiplex: no visible binding for global variable ‘output’
plot_demultiplex: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count
  bam_index barcode barcode_rank cell_total_reads chisq.test count
  counts_no_ins cumpct demultiplexed reads everything expr filter_res
  head imageX imageY in_tissue input length_bin max_length min_length
  multi-matching reads mutation_index n_reads na.omit name nucleotide
  output p.value pct pos read1_with_adapter read_counts ref
  scale_alpha_continuous scale_colour_gradient single match reads
  starts_with test total total reads total_counts tr_length transcript
  undemultiplexted reads value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("stats", "chisq.test", "na.omit")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  bulk_long_pipeline.Rd: SummarizedExperiment
  sc_long_multisample_pipeline.Rd: SingleCellExperiment
  sc_long_pipeline.Rd: SingleCellExperiment
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
bulk_long_pipeline           30.156  2.497  31.752
create_se_from_dir           24.632  0.741  21.784
plot_isoform_reduced_dim     25.033  0.332  25.626
sc_long_multisample_pipeline 21.818  3.080  20.923
sc_DTU_analysis              11.462  1.627  11.364
create_sce_from_dir           9.439  1.823  12.509
find_isoform                  9.475  0.246   9.811
get_GRangesList               9.311  0.204   9.535
minimap2_align                9.165  0.204   9.391
plot_isoform_heatmap          8.915  0.336   9.303
sc_long_pipeline              6.863  1.297   6.555
plot_coverage                 6.799  0.210   7.018
get_coverage                  5.055  0.231   5.300
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’
for details.


Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.2.0’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
  unsigned int end;
               ^
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -std=gnu2x -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
ld: warning: ignoring duplicate libraries: '-lz'
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpNv82sY/file152602b9931d4/config_file_86624.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file152602b17b8e4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file15260729c1f47/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file15260729c1f47/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpNv82sY/file15260687cdd8a/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file15260687cdd8a/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file15260687cdd8a/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file15260687cdd8a/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file15260b14f857/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file15260b14f857/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpNv82sY/file152603930ab1b/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file152603930ab1b/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file152603930ab1b/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpNv82sY/file152603930ab1b/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file15260b14f857/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpNv82sY/file152607b299f25/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 22.868   1.181  24.225 

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
add_gene_counts0.5310.0290.563
annotation_to_fasta1.2650.0291.299
blaze0.3780.0601.969
bulk_long_pipeline30.156 2.49731.752
combine_sce0.9310.0140.946
convolution_filter0.0010.0010.001
create_config0.0060.0010.007
create_sce_from_dir 9.439 1.82312.509
create_se_from_dir24.632 0.74121.784
cutadapt0.1710.0670.239
filter_annotation0.6900.0440.736
filter_coverage4.6640.2254.920
find_barcode1.1180.2771.442
find_bin0.0100.0110.024
find_isoform9.4750.2469.811
find_variants4.5520.3534.950
get_GRangesList9.3110.2049.535
get_coverage5.0550.2315.300
minimap2_align9.1650.2049.391
minimap2_realign0.7030.0830.793
mutation_positions1.8080.0251.837
plot_coverage6.7990.2107.018
plot_demultiplex1.2670.1081.380
plot_isoform_heatmap8.9150.3369.303
plot_isoform_reduced_dim25.033 0.33225.626
plot_isoforms2.9970.0163.038
quantify_transcript1.9490.0712.041
quantify_transcript_flames1.6410.0671.745
sc_DTU_analysis11.462 1.62711.364
sc_impute_transcript0.6250.0100.637
sc_long_multisample_pipeline21.818 3.08020.923
sc_long_pipeline6.8631.2976.555
sc_mutations2.3960.4192.886
weight_transcripts0.0240.0210.045