Changqing Wang
| Snapshot Date: 2025-01-20 13:00 -0500 (Mon, 20 Jan 2025) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: RELEASE_3_20 |
| git_last_commit: 8b0f8a9 |
| git_last_commit_date: 2024-12-05 19:57:26 -0500 (Thu, 05 Dec 2024) |
| Back to Multiple platform build/check report for BioC 3.20: simplified long |
|
This page was generated on 2025-01-23 12:10 -0500 (Thu, 23 Jan 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 24.04.1 LTS) | x86_64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4746 |
| palomino8 | Windows Server 2022 Datacenter | x64 | 4.4.2 (2024-10-31 ucrt) -- "Pile of Leaves" | 4493 |
| merida1 | macOS 12.7.5 Monterey | x86_64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4517 |
| kjohnson1 | macOS 13.6.6 Ventura | arm64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4469 |
| taishan | Linux (openEuler 24.03 LTS) | aarch64 | 4.4.2 (2024-10-31) -- "Pile of Leaves" | 4394 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 721/2289 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.0.2 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 24.04.1 LTS) / x86_64 | OK | OK | OK | | ||||||||
| palomino8 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| merida1 | macOS 12.7.5 Monterey / x86_64 | OK | OK | OK | OK | | ||||||||
| kjohnson1 | macOS 13.6.6 Ventura / arm64 | OK | OK | OK | OK | | ||||||||
| taishan | Linux (openEuler 24.03 LTS) / aarch64 | OK | OK | ERROR | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.0.2 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.0.2.tar.gz |
| StartedAt: 2025-01-21 19:33:35 -0500 (Tue, 21 Jan 2025) |
| EndedAt: 2025-01-21 19:45:23 -0500 (Tue, 21 Jan 2025) |
| EllapsedTime: 708.6 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.0.2.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.2 (2024-10-31)
* using platform: aarch64-apple-darwin20
* R was compiled by
Apple clang version 14.0.0 (clang-1400.0.29.202)
GNU Fortran (GCC) 12.2.0
* running under: macOS Ventura 13.7.1
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.0.2’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
Not all R platforms support C++17
* checking installed package size ... NOTE
installed size is 5.2Mb
sub-directories of 1Mb or more:
data 2.7Mb
libs 1.4Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
create_spe: no visible binding for global variable 'barcode'
filter_coverage: no visible global function definition for
'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
'which_label'
find_variants_grange: no visible binding for global variable
'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
reads'
plot_demultiplex: no visible binding for global variable 'single match
reads'
plot_demultiplex: no visible binding for global variable
'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
plot_spatial_isoform: no visible global function definition for 'head'
plot_spatial_pie: no visible global function definition for 'head'
plot_spatial_pie: no visible binding for global variable 'imageY'
plot_spatial_pie: no visible binding for global variable 'imageX'
relative_mutation_positions: no visible binding for global variable
'region'
relative_mutation_positions_single: no visible binding for global
variable 'type'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
'cell_total_reads'
Undefined global functions or variables:
. BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
allele_count bam_index barcode barcode_rank cell_id cell_total_reads
cnt count counts_no_ins cumpct demultiplexed reads everything expr
filter_res gene_id head imageX imageY input label length_bin
max_length min_length multi-matching reads mutation_index n_reads
name nucleotide output pct pos read1_with_adapter read_counts ref
region single match reads starts_with total reads total_counts tr_id
tr_length transcript type undemultiplexted reads value which_label x
y
Consider adding
importFrom("base", "match", "single")
importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
Found ‘___assert_rtn’, possibly from ‘assert’ (C)
Found ‘___stderrp’, possibly from ‘stderr’ (C)
Found ‘___stdoutp’, possibly from ‘stdout’ (C)
Found ‘_abort’, possibly from ‘abort’ (C)
Found ‘_exit’, possibly from ‘exit’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
bulk_long_pipeline 27.237 1.313 27.471
plot_isoform_reduced_dim 25.699 0.534 26.288
create_se_from_dir 24.903 0.652 21.945
sc_long_multisample_pipeline 12.939 3.180 14.623
create_sce_from_dir 8.198 2.057 11.434
find_isoform 9.665 0.270 9.949
get_GRangesList 9.005 0.208 9.239
minimap2_align 8.996 0.190 9.217
plot_coverage 8.438 0.239 8.758
relative_mutation_positions 7.245 0.127 8.404
filter_coverage 6.425 0.206 6.658
get_coverage 5.510 0.239 5.752
find_variants 4.599 0.539 5.145
sc_DTU_analysis 3.881 1.151 4.828
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 5 NOTEs
See
‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang -arch arm64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation ld: warning: ignoring duplicate libraries: '-lz' if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices *** copying figures ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.4.2 (2024-10-31) -- "Pile of Leaves"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/RtmpZLUkRZ/filec5ff5170e58d/config_file_50687.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff4da8b88/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff9c4616a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff9c4616a/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpZLUkRZ/filec5ff3fd69dc9/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ff3fd69dc9/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ff3fd69dc9/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ff3fd69dc9/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff6731a1a0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff6731a1a0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpZLUkRZ/filec5ffdaa5253/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ffdaa5253/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ffdaa5253/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpZLUkRZ/filec5ffdaa5253/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff6731a1a0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZLUkRZ/filec5ff5e3c69f5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.4-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
>
> proc.time()
user system elapsed
24.559 1.226 25.876
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| annotation_to_fasta | 1.617 | 0.055 | 1.816 | |
| blaze | 0.376 | 0.056 | 2.546 | |
| bulk_long_pipeline | 27.237 | 1.313 | 27.471 | |
| combine_sce | 0.872 | 0.073 | 0.945 | |
| convolution_filter | 0.001 | 0.000 | 0.001 | |
| create_config | 0.006 | 0.002 | 0.006 | |
| create_sce_from_dir | 8.198 | 2.057 | 11.434 | |
| create_se_from_dir | 24.903 | 0.652 | 21.945 | |
| cutadapt | 0.000 | 0.000 | 0.001 | |
| filter_annotation | 0.646 | 0.007 | 0.654 | |
| filter_coverage | 6.425 | 0.206 | 6.658 | |
| find_barcode | 0.934 | 0.270 | 1.203 | |
| find_bin | 0.010 | 0.015 | 0.029 | |
| find_isoform | 9.665 | 0.270 | 9.949 | |
| find_variants | 4.599 | 0.539 | 5.145 | |
| get_GRangesList | 9.005 | 0.208 | 9.239 | |
| get_coverage | 5.510 | 0.239 | 5.752 | |
| minimap2_align | 8.996 | 0.190 | 9.217 | |
| minimap2_realign | 0.783 | 0.081 | 0.870 | |
| parse_gff_tree | 0.306 | 0.021 | 0.331 | |
| plot_coverage | 8.438 | 0.239 | 8.758 | |
| plot_demultiplex | 1.346 | 0.317 | 1.667 | |
| plot_isoform_heatmap | 4.151 | 0.341 | 4.508 | |
| plot_isoform_reduced_dim | 25.699 | 0.534 | 26.288 | |
| plot_isoforms | 2.729 | 0.015 | 2.746 | |
| quantify_transcript | 1.765 | 0.067 | 2.035 | |
| quantify_transcript_flames | 2.187 | 0.084 | 2.407 | |
| relative_mutation_positions | 7.245 | 0.127 | 8.404 | |
| sc_DTU_analysis | 3.881 | 1.151 | 4.828 | |
| sc_impute_transcript | 0.733 | 0.108 | 0.911 | |
| sc_long_multisample_pipeline | 12.939 | 3.180 | 14.623 | |
| sc_long_pipeline | 3.482 | 0.821 | 3.515 | |
| sc_mutations | 2.267 | 0.584 | 2.868 | |
| weight_transcripts | 0.027 | 0.015 | 0.041 | |