| Back to Multiple platform build/check report for BioC 3.13 |
|
This page was generated on 2021-10-15 15:06:56 -0400 (Fri, 15 Oct 2021).
|
To the developers/maintainers of the tRNAdbImport package: - Please allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/tRNAdbImport.git to reflect on this report. See How and When does the builder pull? When will my changes propagate? here for more information. - Make sure to use the following settings in order to reproduce any error or warning you see on this page. |
| Package 1966/2041 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| tRNAdbImport 1.10.0 (landing page) Felix G.M. Ernst
| nebbiolo1 | Linux (Ubuntu 20.04.2 LTS) / x86_64 | OK | OK | OK |  | ||||||||
| tokay2 | Windows Server 2012 R2 Standard / x64 | OK | OK | OK | OK | | ||||||||
| machv2 | macOS 10.14.6 Mojave / x86_64 | OK | OK | ERROR | OK | |||||||||
| Package: tRNAdbImport |
| Version: 1.10.0 |
| Command: /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --install=check:tRNAdbImport.install-out.txt --library=/Library/Frameworks/R.framework/Versions/Current/Resources/library --no-vignettes --timings tRNAdbImport_1.10.0.tar.gz |
| StartedAt: 2021-10-15 00:58:38 -0400 (Fri, 15 Oct 2021) |
| EndedAt: 2021-10-15 01:01:18 -0400 (Fri, 15 Oct 2021) |
| EllapsedTime: 160.2 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: tRNAdbImport.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --install=check:tRNAdbImport.install-out.txt --library=/Library/Frameworks/R.framework/Versions/Current/Resources/library --no-vignettes --timings tRNAdbImport_1.10.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.13-bioc/meat/tRNAdbImport.Rcheck’
* using R version 4.1.1 (2021-08-10)
* using platform: x86_64-apple-darwin17.0 (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘tRNAdbImport/DESCRIPTION’ ... OK
* this is package ‘tRNAdbImport’ version ‘1.10.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
.git_fetch_output.txt
.git_merge_output.txt
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘tRNAdbImport’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: ‘BiocGenerics’
All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘tRNAdbImport-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: import.tRNAdb
> ### Title: Importing information from the tRNA db as GRanges object
> ### Aliases: import.tRNAdb import.mttRNAdb import.tRNAdb.id
> ### import.mttRNAdb.id import.tRNAdb.blast import.mttRNAdb.blast
> ### tRNAdb2GFF TRNA_DB_URL TRNA_DB_URL_MT
> ### Keywords: datasets
>
> ### ** Examples
>
> import.tRNAdb(organism = "Saccharomyces cerevisiae",
+ aminoacids = c("Phe","Ala"))
GRanges object with 13 ranges and 15 metadata columns:
seqnames ranges strand | no tRNA_length tRNA_type
<Rle> <IRanges> <Rle> | <integer> <integer> <character>
[1] tdbD00000218 1-73 * | 1 73 Ala
[2] tdbD00000219 1-73 * | 2 73 Ala
[3] tdbD00000785 1-73 * | 3 73 Phe
[4] tdbD00000786 1-73 * | 4 73 Phe
[5] tdbD00000787 1-73 * | 5 73 Phe
... ... ... ... . ... ... ...
[9] tdbD00005005 1-73 * | 9 73 Phe
[10] tdbD00005006 1-73 * | 10 73 Phe
[11] tdbD00005007 1-73 * | 11 73 Phe
[12] tdbD00005008 1-73 * | 12 73 Phe
[13] tdbD00005009 1-73 * | 13 73 Phe
tRNA_anticodon tRNA_seq tRNA_str
<character> <DNAStringSet> <DotBracketStringSet>
[1] TGC GGGCACATGG...GTTGCGTCCA <<<<.<<..<...>>>>.>>>>.
[2] AGC GGGCGTGTGG...GACTCGTCCA <<<<<.<..<...>>>.>>>>>.
[3] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
[4] GAA GCGGATTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>.
[5] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
... ... ... ...
[9] GAA GCGGACTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>.
[10] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
[11] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
[12] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
[13] GAA GCGGACTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>.
tRNA_CCA.end tRNAdb tRNAdb_ID tRNAdb_organism
<logical> <character> <character> <character>
[1] FALSE DNA tdbD00000218 Saccharomyces cerevi..
[2] FALSE DNA tdbD00000219 Saccharomyces cerevi..
[3] FALSE DNA tdbD00000785 Saccharomyces cerevi..
[4] FALSE DNA tdbD00000786 Saccharomyces cerevi..
[5] FALSE DNA tdbD00000787 Saccharomyces cerevi..
... ... ... ... ...
[9] FALSE DNA tdbD00005005 Saccharomyces cerevi..
[10] FALSE DNA tdbD00005006 Saccharomyces cerevi..
[11] FALSE DNA tdbD00005007 Saccharomyces cerevi..
[12] FALSE DNA tdbD00005008 Saccharomyces cerevi..
[13] FALSE DNA tdbD00005009 Saccharomyces cerevi..
tRNAdb_strain tRNAdb_taxonomyID tRNAdb_verified tRNAdb_reference
<character> <character> <logical> <CharacterList>
[1] 4932 FALSE H.J.DRABKIN, U.L.RAJ..
[2] 4932 FALSE F.CREUSOT, M.GAISNE,..
[3] 4932 FALSE P.VALENZUELA, A.VENE..
[4] 4932 FALSE P.BULL ET AL. (1987)..
[5] 4932 FALSE A.GOFFEAU ET AL. (19..
... ... ... ... ...
[9] unk 4932 FALSE Lowe, T.M. & Eddy, S..
[10] unk 4932 FALSE Lowe, T.M. & Eddy, S..
[11] unk 4932 FALSE Lowe, T.M. & Eddy, S..
[12] unk 4932 FALSE Lowe, T.M. & Eddy, S..
[13] unk 4932 FALSE Lowe, T.M. & Eddy, S..
tRNAdb_pmid
<CharacterList>
[1]
[2]
[3]
[4]
[5]
... ...
[9] 9023104
[10] 9023104
[11] 9023104
[12] 9023104
[13] 9023104
-------
seqinfo: 13 sequences from an unspecified genome; no seqlengths
> import.tRNAdb.id(tdbID = "tdbD00000785")
GRanges object with 1 range and 15 metadata columns:
seqnames ranges strand | no tRNA_length tRNA_type
<Rle> <IRanges> <Rle> | <integer> <integer> <character>
[1] tdbD00000785 1-73 * | 1 73 Phe
tRNA_anticodon tRNA_seq tRNA_str
<character> <DNAStringSet> <DotBracketStringSet>
[1] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>.
tRNA_CCA.end tRNAdb tRNAdb_ID tRNAdb_organism
<logical> <character> <character> <character>
[1] FALSE DNA tdbD00000785 Saccharomyces cerevi..
tRNAdb_strain tRNAdb_taxonomyID tRNAdb_verified tRNAdb_reference
<character> <character> <logical> <CharacterList>
[1] 4932 FALSE P.VALENZUELA, A.VENE..
tRNAdb_pmid
<CharacterList>
[1]
-------
seqinfo: 1 sequence from an unspecified genome; no seqlengths
> import.tRNAdb.blast(blastSeq =
+ "GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCA")
Error in curl::curl_fetch_memory(url, handle = handle) :
transfer closed with outstanding read data remaining
Calls: import.tRNAdb.blast ... request_fetch -> request_fetch.write_memory -> <Anonymous>
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 2 NOTEs
See
‘/Users/biocbuild/bbs-3.13-bioc/meat/tRNAdbImport.Rcheck/00check.log’
for details.
tRNAdbImport.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD INSTALL tRNAdbImport ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.1/Resources/library’ * installing *source* package ‘tRNAdbImport’ ... ** using staged installation ** R ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (tRNAdbImport)
tRNAdbImport.Rcheck/tests/testthat.Rout
R version 4.1.1 (2021-08-10) -- "Kick Things"
Copyright (C) 2021 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin17.0 (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> library(testthat)
> library(httptest)
> library(tRNAdbImport)
Loading required package: GenomicRanges
Loading required package: stats4
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, basename, cbind, colnames, dirname, do.call,
duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin,
pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table,
tapply, union, unique, unsplit, which.max, which.min
Loading required package: S4Vectors
Attaching package: 'S4Vectors'
The following objects are masked from 'package:base':
I, expand.grid, unname
Loading required package: IRanges
Loading required package: GenomeInfoDb
Loading required package: Modstrings
Loading required package: Biostrings
Loading required package: XVector
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
Loading required package: Structstrings
Loading required package: tRNA
>
> test_check("tRNAdbImport")
══ Skipped tests ═══════════════════════════════════════════════════════════════
• On CRAN (1)
[ FAIL 0 | WARN 0 | SKIP 1 | PASS 15 ]
>
> proc.time()
user system elapsed
6.524 0.378 7.242
tRNAdbImport.Rcheck/tRNAdbImport-Ex.timings
| name | user | system | elapsed |