Back to Multiple platform build/check report for BioC 3.20:   simplified   long
ABCDEFGHIJKLMNOPQ[R]STUVWXYZ

This page was generated on 2024-11-20 12:02 -0500 (Wed, 20 Nov 2024).

HostnameOSArch (*)R versionInstalled pkgs
teran2Linux (Ubuntu 24.04.1 LTS)x86_644.4.2 (2024-10-31) -- "Pile of Leaves" 4481
nebbiolo2Linux (Ubuntu 24.04.1 LTS)x86_644.4.2 (2024-10-31) -- "Pile of Leaves" 4479
palomino8Windows Server 2022 Datacenterx644.4.2 (2024-10-31 ucrt) -- "Pile of Leaves" 4359
lconwaymacOS 12.7.1 Montereyx86_644.4.1 (2024-06-14) -- "Race for Your Life" 4539
kunpeng2Linux (openEuler 22.03 LTS-SP1)aarch644.4.1 (2024-06-14) -- "Race for Your Life" 4493
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 1729/2289HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
rfaRm 1.18.0  (landing page)
Lara Selles Vidal
Snapshot Date: 2024-11-19 13:40 -0500 (Tue, 19 Nov 2024)
git_url: https://git.bioconductor.org/packages/rfaRm
git_branch: RELEASE_3_20
git_last_commit: e0b1719
git_last_commit_date: 2024-10-29 10:45:58 -0500 (Tue, 29 Oct 2024)
teran2Linux (Ubuntu 24.04.1 LTS) / x86_64  OK    OK    ERROR  
nebbiolo2Linux (Ubuntu 24.04.1 LTS) / x86_64  OK    OK    ERROR  
palomino8Windows Server 2022 Datacenter / x64  OK    OK    ERROR    OK  
lconwaymacOS 12.7.1 Monterey / x86_64  OK    OK    ERROR    OK  
kunpeng2Linux (openEuler 22.03 LTS-SP1) / aarch64  OK    ERROR  skipped


CHECK results for rfaRm on teran2

To the developers/maintainers of the rfaRm package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: rfaRm
Version: 1.18.0
Command: /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings rfaRm_1.18.0.tar.gz
StartedAt: 2024-11-20 08:22:06 -0500 (Wed, 20 Nov 2024)
EndedAt: 2024-11-20 08:24:44 -0500 (Wed, 20 Nov 2024)
EllapsedTime: 157.9 seconds
RetCode: 1
Status:   ERROR  
CheckDir: rfaRm.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings rfaRm_1.18.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/meat/rfaRm.Rcheck’
* using R version 4.4.2 (2024-10-31)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.2.0-23ubuntu4) 13.2.0
    GNU Fortran (Ubuntu 13.2.0-23ubuntu4) 13.2.0
* running under: Ubuntu 24.04.1 LTS
* using session charset: UTF-8
* checking for file ‘rfaRm/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘rfaRm’ version ‘1.18.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘rfaRm’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for ‘as’
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... WARNING
Error: package or namespace load failed for ‘rfaRm’:
 .onLoad failed in loadNamespace() for 'rfaRm', details:
  call: readLines(clanMembershipCon)
  error: cannot open the connection to 'https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/database_files/clan_membership.txt.gz'
Call sequence:
6: stop(msg, call. = FALSE, domain = NA)
5: value[[3L]](cond)
4: tryCatchOne(expr, names, parentenv, handlers[[1L]])
3: tryCatchList(expr, classes, parentenv, handlers)
2: tryCatch({
       attr(package, "LibPath") <- which.lib.loc
       ns <- loadNamespace(package, lib.loc)
       env <- attachNamespace(ns, pos = pos, deps, exclude, include.only)
   }, error = function(e) {
       P <- if (!is.null(cc <- conditionCall(e))) 
           paste(" in", deparse(cc)[1L])
       else ""
       msg <- gettextf("package or namespace load failed for %s%s:\n %s", 
           sQuote(package), P, conditionMessage(e))
       if (logical.return && !quietly) 
           message(paste("Error:", msg), domain = NA)
Execution halted
All user-level objects in a package should have documentation entries.
See chapter ‘Writing R documentation files’ in the ‘Writing R
Extensions’ manual.
* checking for code/documentation mismatches ... WARNING
Error: package or namespace load failed for ‘rfaRm’:
 .onLoad failed in loadNamespace() for 'rfaRm', details:
  call: readLines(clanMembershipCon)
  error: cannot open the connection to 'https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/database_files/clan_membership.txt.gz'
Call sequence:
6: stop(msg, call. = FALSE, domain = NA)
5: value[[3L]](cond)
4: tryCatchOne(expr, names, parentenv, handlers[[1L]])
3: tryCatchList(expr, classes, parentenv, handlers)
2: tryCatch({
       attr(package, "LibPath") <- which.lib.loc
       ns <- loadNamespace(package, lib.loc)
       env <- attachNamespace(ns, pos = pos, deps, exclude, include.only)
   }, error = function(e) {
       P <- if (!is.null(cc <- conditionCall(e))) 
           paste(" in", deparse(cc)[1L])
       else ""
       msg <- gettextf("package or namespace load failed for %s%s:\n %s", 
           sQuote(package), P, conditionMessage(e))
       if (logical.return && !quietly) 
           message(paste("Error:", msg), domain = NA)
Execution halted
Error: package or namespace load failed for ‘rfaRm’:
 .onLoad failed in loadNamespace() for 'rfaRm', details:
  call: readLines(clanMembershipCon)
  error: cannot open the connection to 'https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/database_files/clan_membership.txt.gz'
Call sequence:
6: stop(msg, call. = FALSE, domain = NA)
5: value[[3L]](cond)
4: tryCatchOne(expr, names, parentenv, handlers[[1L]])
3: tryCatchList(expr, classes, parentenv, handlers)
2: tryCatch({
       attr(package, "LibPath") <- which.lib.loc
       ns <- loadNamespace(package, lib.loc)
       env <- attachNamespace(ns, pos = pos, deps, exclude, include.only)
   }, error = function(e) {
       P <- if (!is.null(cc <- conditionCall(e))) 
           paste(" in", deparse(cc)[1L])
       else ""
       msg <- gettextf("package or namespace load failed for %s%s:\n %s", 
           sQuote(package), P, conditionMessage(e))
       if (logical.return && !quietly) 
           message(paste("Error:", msg), domain = NA)
Execution halted
Error: package or namespace load failed for ‘rfaRm’:
 .onLoad failed in loadNamespace() for 'rfaRm', details:
  call: readLines(clanMembershipCon)
  error: cannot open the connection to 'https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/database_files/clan_membership.txt.gz'
Call sequence:
6: stop(msg, call. = FALSE, domain = NA)
5: value[[3L]](cond)
4: tryCatchOne(expr, names, parentenv, handlers[[1L]])
3: tryCatchList(expr, classes, parentenv, handlers)
2: tryCatch({
       attr(package, "LibPath") <- which.lib.loc
       ns <- loadNamespace(package, lib.loc)
       env <- attachNamespace(ns, pos = pos, deps, exclude, include.only)
   }, error = function(e) {
       P <- if (!is.null(cc <- conditionCall(e))) 
           paste(" in", deparse(cc)[1L])
       else ""
       msg <- gettextf("package or namespace load failed for %s%s:\n %s", 
           sQuote(package), P, conditionMessage(e))
       if (logical.return && !quietly) 
           message(paste("Error:", msg), domain = NA)
Execution halted
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘rfaRm-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument
Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous>
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 ERROR
Running the tests in ‘tests/runTests.R’ failed.
Last 13 lines of output:
  
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument
  
  Test files with failing tests
  
     test_searchFunctions.R 
       /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... ERROR
Error(s) in re-building vignettes:
  ...
--- re-building ‘rfaRm.Rmd’ using rmarkdown
Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-2'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.

Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-3'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.


Quitting from lines 74-83 [unnamed-chunk-3] (rfaRm.Rmd)
Error: processing vignette 'rfaRm.Rmd' failed with diagnostics:
non-character argument
--- failed re-building ‘rfaRm.Rmd’

SUMMARY: processing the following file failed:
  ‘rfaRm.Rmd’

Error: Vignette re-building failed.
Execution halted

* checking PDF version of manual ... OK
* DONE

Status: 3 ERRORs, 2 WARNINGs, 1 NOTE
See
  ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/meat/rfaRm.Rcheck/00check.log’
for details.


Installation output

rfaRm.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD INSTALL rfaRm
###
##############################################################################
##############################################################################


* installing to library ‘/media/volume/teran2_disk/biocbuild/bbs-3.20-bioc/R/site-library’
* installing *source* package ‘rfaRm’ ...
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (rfaRm)

Tests output

rfaRm.Rcheck/tests/runTests.Rout.fail


R version 4.4.2 (2024-10-31) -- "Pile of Leaves"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.58.0
No encoding supplied: defaulting to UTF-8.
  format width height colorspace matte filesize density
1    SVG   700    550       sRGB  TRUE    21504   72x72
  format width height colorspace matte filesize density
1    GIF   600   2084       sRGB FALSE    63951   72x72
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument


RUNIT TEST PROTOCOL -- Wed Nov 20 08:24:23 2024 
*********************************************** 
Number of test functions: 1 
Number of errors: 1 
Number of failures: 0 

 
1 Test Suite : 
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument

Test files with failing tests

   test_searchFunctions.R 
     /tmp/RtmpAmiUAQ/RLIBS_1aae62588bfba0/rfaRm/unitTests/test_searchFunctions.R 


Error in BiocGenerics:::testPackage("rfaRm") : 
  unit tests failed for package rfaRm
Execution halted

Example timings

rfaRm.Rcheck/rfaRm-Ex.timings

nameusersystemelapsed
rfamConsensusSecondaryStructure0.3220.0252.831
rfamCovarianceModel0.0700.0130.837
rfamFamilyAccessionToID0.0180.0010.142
rfamFamilyIDToAccession0.0090.0020.129
rfamFamilySummary0.0760.0110.827
rfamPDBMapping0.0730.0050.632
rfamSecondaryStructurePlot4.7280.1226.572
rfamSecondaryStructureXMLSVG0.0390.0010.709
rfamSeedAlignment0.2950.0052.422
rfamSeedTree0.0640.0000.629
rfamSeedTreeImage0.0690.0100.614
rfamSequenceRegions0.1490.0053.285