| Back to Multiple platform build/check report for BioC 3.22: simplified long |
|
This page was generated on 2025-11-01 12:03 -0400 (Sat, 01 Nov 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 Patched (2025-08-23 r88802) -- "Great Square Root" | 4901 |
| lconway | macOS 12.7.6 Monterey | x86_64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4691 |
| kjohnson3 | macOS 13.7.7 Ventura | arm64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4637 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 996/2361 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
Nirav V Malani
| nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | ERROR | |||||||||
| lconway | macOS 12.7.6 Monterey / x86_64 | OK | OK | ERROR | OK | |||||||||
| kjohnson3 | macOS 13.7.7 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
|
To the developers/maintainers of the hiReadsProcessor package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/hiReadsProcessor.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: hiReadsProcessor |
| Version: 1.46.0 |
| Command: /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.46.0.tar.gz |
| StartedAt: 2025-11-01 00:38:25 -0400 (Sat, 01 Nov 2025) |
| EndedAt: 2025-11-01 00:43:21 -0400 (Sat, 01 Nov 2025) |
| EllapsedTime: 296.4 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: hiReadsProcessor.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.46.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck’
* using R version 4.5.1 Patched (2025-08-23 r88802)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.3 LTS
* using session charset: UTF-8
* checking for file ‘hiReadsProcessor/DESCRIPTION’ ... OK
* this is package ‘hiReadsProcessor’ version ‘1.46.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
.BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘hiReadsProcessor’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
chunkize: no visible global function definition for ‘breakInChunks’
chunkize: no visible global function definition for ‘detectCores’
clusterSites : <anonymous>: no visible binding for global variable
‘queryHits’
clusterSites: no visible binding for global variable ‘clusteredValue’
clusterSites: no visible binding for global variable
‘clusteredValue.freq’
crossOverCheck: no visible binding for global variable ‘queryHits’
decodeByBarcode: no visible global function definition for ‘metadata<-’
decodeByBarcode: no visible global function definition for ‘metadata’
extractSeqs : <anonymous>: no visible global function definition for
‘metadata’
extractSeqs : <anonymous> : <anonymous> : <anonymous>: no visible
global function definition for ‘IRanges’
extractSeqs : <anonymous> : <anonymous>: no visible global function
definition for ‘IRanges’
findBarcodes: no visible global function definition for ‘metadata<-’
findBarcodes: no visible global function definition for ‘metadata’
findIntegrations: no visible global function definition for
‘fasta.info’
findIntegrations : <anonymous>: no visible global function definition
for ‘IRanges’
findVector : <anonymous>: no visible global function definition for
‘IRanges’
pairUpAlignments : <anonymous>: no visible binding for global variable
‘queryHits’
pairwiseAlignSeqs: no visible global function definition for
‘IRangesList’
pairwiseAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for
‘IRangesList’
pslToRangedObject: no visible global function definition for ‘IRanges’
read.BAMasPSL: no visible global function definition for ‘ScanBamParam’
read.BAMasPSL: no visible global function definition for ‘scanBamFlag’
read.BAMasPSL: no visible global function definition for ‘DataFrame’
read.SeqFolder: no visible global function definition for ‘SimpleList’
read.psl: no visible global function definition for ‘mclapply’
read.psl : <anonymous>: no visible binding for global variable
‘matches’
read.psl : <anonymous>: no visible binding for global variable
‘misMatches’
read.psl : <anonymous>: no visible binding for global variable
‘qBaseInsert’
read.psl : <anonymous>: no visible binding for global variable
‘tBaseInsert’
read.psl: no visible binding for global variable ‘matches’
read.psl: no visible binding for global variable ‘misMatches’
read.psl: no visible binding for global variable ‘qBaseInsert’
read.psl: no visible binding for global variable ‘tBaseInsert’
read.sampleInfo: no visible global function definition for ‘SimpleList’
splitSeqsToFiles: no visible global function definition for
‘fasta.info’
vpairwiseAlignSeqs: no visible global function definition for ‘Rle’
vpairwiseAlignSeqs: no visible global function definition for
‘runLength’
vpairwiseAlignSeqs: no visible global function definition for ‘IRanges’
vpairwiseAlignSeqs: no visible global function definition for
‘runValue’
Undefined global functions or variables:
DataFrame IRanges IRangesList Rle ScanBamParam SimpleList
breakInChunks clusteredValue clusteredValue.freq detectCores
fasta.info matches mclapply metadata metadata<- misMatches
qBaseInsert queryHits runLength runValue scanBamFlag tBaseInsert
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
annotateSites.Rd: SerialParam, doAnnotation
blatSeqs.Rd: BiocParallel, SerialParam
clusterSites.Rd: BiocParallel, SerialParam
doRCtest.Rd: vcountPattern, BiocParallel, SerialParam
findAndRemoveVector.Rd: BiocParallel, SerialParam, MulticoreParam,
SnowParam
findAndTrimSeq.Rd: vmatchPattern, pairwiseAlignment, MulticoreParam,
SnowParam
findIntegrations.Rd: BiocParallel, SerialParam, MulticoreParam,
SnowParam
findLTRs.Rd: BiocParallel, SerialParam, pairwiseAlignment,
MulticoreParam, SnowParam
findLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment,
MulticoreParam, SnowParam
findPrimers.Rd: vmatchPattern, pairwiseAlignment, SerialParam,
MulticoreParam, SnowParam
findVector.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
getSonicAbund.Rd: sonicLength, BiocParallel, SerialParam
isuSites.Rd: BiocParallel, SerialParam
otuSites.Rd: BiocParallel, SerialParam
pairUpAlignments.Rd: BiocParallel, SerialParam
pairwiseAlignSeqs.Rd: pairwiseAlignment, BiocParallel, SerialParam,
MulticoreParam, SnowParam
primerIDAlignSeqs.Rd: pairwiseAlignment
read.blast8.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
read.psl.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
troubleshootLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment,
MulticoreParam, SnowParam
vpairwiseAlignSeqs.Rd: vmatchPattern, BiocParallel, SerialParam,
MulticoreParam, SnowParam
write.listedDNAStringSet.Rd: BiocParallel, SerialParam,
writeXStringSet, MulticoreParam, SnowParam
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘hiReadsProcessor-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: findAndTrimSeq
> ### Title: Find and trim a short pattern sequence from the subject.
> ### Aliases: findAndTrimSeq
>
> ### ** Examples
>
> findAndTrimSeq(patternSeq="AGACCCTTTT",
+ subjectSeqs=DNAStringSet(c("AGACCCTTTTGAGCAGCAT","AGACCCTTGGTCGACTCA",
+ "AGACCCTTTTGACGAGCTAG")), qualityThreshold=.85, doRC=FALSE, side="left",
+ offBy=1, alignWay = "slow")
Error in (function (cond) :
error in evaluating the argument 'x' in selecting a method for function 'start': pattern() has moved from Biostrings to the pwalign package, and is formally
defunct in Biostrings >= 2.77.1. Please call pwalign::pattern() to get rid of
this error.
Calls: findAndTrimSeq ... start -> pattern -> .call_fun_in_pwalign -> .Defunct
Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 3 NOTEs
See
‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck/00check.log’
for details.
hiReadsProcessor.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD INSTALL hiReadsProcessor ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.22-bioc/R/site-library’ * installing *source* package ‘hiReadsProcessor’ ... ** this is package ‘hiReadsProcessor’ version ‘1.46.0’ ** using staged installation ** R ** data ** inst ** byte-compile and prepare package for lazy loading Warning message: In fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location Warning in fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 Warning in fun(libname, pkgname) : Package 'hiReadsProcessor' is deprecated and will be removed from Bioconductor version 3.23 ** testing if installed package can be loaded from final location Warning in fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 Warning in fun(libname, pkgname) : Package 'hiReadsProcessor' is deprecated and will be removed from Bioconductor version 3.23 ** testing if installed package keeps a record of temporary installation path * DONE (hiReadsProcessor)
hiReadsProcessor.Rcheck/hiReadsProcessor-Ex.timings
| name | user | system | elapsed | |
| addFeature | 0.201 | 0.011 | 0.213 | |
| addListNameToReads | 0.249 | 0.003 | 0.253 | |
| annotateSites | 0.000 | 0.000 | 0.001 | |
| blatSeqs | 0 | 0 | 0 | |
| chunkize | 0.029 | 0.000 | 0.030 | |
| clusterSites | 0.323 | 0.000 | 0.323 | |
| crossOverCheck | 0.094 | 0.000 | 0.094 | |
| dereplicateReads | 0.038 | 0.001 | 0.039 | |
| doRCtest | 4.147 | 0.138 | 4.303 | |
| extractFeature | 0.148 | 0.094 | 0.129 | |
| extractSeqs | 0.362 | 0.024 | 0.385 | |