Back to Multiple platform build/check report for BioC 3.23:   simplified   long
[A]BCDEFGHIJKLMNOPQRSTUVWXYZ

This page was generated on 2026-04-30 11:35 -0400 (Thu, 30 Apr 2026).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.4 LTS)x86_644.6.0 RC (2026-04-17 r89917) -- "Because it was There" 4988
kjohnson3macOS 13.7.7 Venturaarm644.6.0 Patched (2026-04-24 r89963) -- "Because it was There" 4718
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 24/2418HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
affxparser 1.84.0  (landing page)
Kasper Daniel Hansen
Snapshot Date: 2026-04-29 13:40 -0400 (Wed, 29 Apr 2026)
git_url: https://git.bioconductor.org/packages/affxparser
git_branch: RELEASE_3_23
git_last_commit: 275088a
git_last_commit_date: 2026-04-28 08:31:19 -0400 (Tue, 28 Apr 2026)
nebbiolo1Linux (Ubuntu 24.04.4 LTS) / x86_64  OK    OK    WARNINGS  UNNEEDED, same version is already published
kjohnson3macOS 13.7.7 Ventura / arm64  OK    OK    WARNINGS    OK  UNNEEDED, same version is already published
See other builds for affxparser in R Universe.


CHECK results for affxparser on kjohnson3

To the developers/maintainers of the affxparser package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/affxparser.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: affxparser
Version: 1.84.0
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.84.0.tar.gz
StartedAt: 2026-04-29 18:21:50 -0400 (Wed, 29 Apr 2026)
EndedAt: 2026-04-29 18:22:14 -0400 (Wed, 29 Apr 2026)
EllapsedTime: 24.3 seconds
RetCode: 0
Status:   WARNINGS  
CheckDir: affxparser.Rcheck
Warnings: 2

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.84.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck’
* using R version 4.6.0 Patched (2026-04-24 r89963)
* using platform: aarch64-apple-darwin23
* R was compiled by
    Apple clang version 17.0.0 (clang-1700.3.19.1)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Tahoe 26.3.1
* using session charset: UTF-8
* current time: 2026-04-29 22:21:50 UTC
* using option ‘--no-vignettes’
* checking for file ‘affxparser/DESCRIPTION’ ... OK
* this is package ‘affxparser’ version ‘1.84.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘affxparser’ can be installed ... WARNING
Found the following significant warnings:
  fusion/calvin_files/utils/src/AffymetrixGuid.cpp:106:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  fusion/util/AffxConv.cpp:122:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
  fusion/util/AffxConv.cpp:178:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  fusion/util/AffxConv.cpp:200:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  fusion/util/AffxConv.cpp:224:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
See ‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck/00install.out’ for details.
* used C compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
* used C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
* used SDK: ‘MacOSX26.2.sdk’
* checking installed package size ... OK
* checking package directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... OK
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... WARNING
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/libs/affxparser.so’:
  Found ‘__ZNSt3__14cerrE’, possibly from ‘std::cerr’ (C++)
  Found ‘__ZNSt3__14coutE’, possibly from ‘std::cout’ (C++)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)
  Found ‘_printf’, possibly from ‘printf’ (C)
  Found ‘_rand’, possibly from ‘rand’ (C)
  Found ‘_sprintf’, possibly from ‘sprintf’ (C)
  Found ‘_srand’, possibly from ‘srand’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking examples ... OK
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘convertCel.R’
  Running ‘readCdfDataFrame.R’
  Running ‘readCdfQc.R’
  Running ‘readCdfUnitsWriteMap.R’
  Running ‘readCdfUnits_etal.R’
  Running ‘readCel.R’
  Running ‘readCelIntensities.R’
  Running ‘readCelRectangle.R’
  Running ‘readCelUnits.R’
  Running ‘readPgf.R’
  Running ‘testWriteAndReadEmptyCdf.R’
  Running ‘testWriteAndReadEmptyCel.R’
 OK
* checking PDF version of manual ... OK
* DONE

Status: 2 WARNINGs
See
  ‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck/00check.log’
for details.


Installation output

affxparser.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL affxparser
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library’
* installing *source* package ‘affxparser’ ...
** this is package ‘affxparser’ version ‘1.84.0’
** using staged installation
** libs
using C compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
using C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
using SDK: ‘MacOSX26.2.sdk’
rm -f fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFData.cpp -o fusion/calvin_files/data/src/CDFData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeGroupInformation.cpp -o fusion/calvin_files/data/src/CDFProbeGroupInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeInformation.cpp -o fusion/calvin_files/data/src/CDFProbeInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFProbeSetInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CELData.cpp -o fusion/calvin_files/data/src/CELData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPBackgroundZone.cpp -o fusion/calvin_files/data/src/CHPBackgroundZone.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPData.cpp -o fusion/calvin_files/data/src/CHPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPExpressionEntry.cpp -o fusion/calvin_files/data/src/CHPExpressionEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPMultiDataData.cpp -o fusion/calvin_files/data/src/CHPMultiDataData.o
fusion/calvin_files/data/src/CHPMultiDataData.cpp:41:27: warning: unused variable 'GENOTYPE_CALL_NAME' [-Wunused-const-variable]
   41 | const static std::wstring GENOTYPE_CALL_NAME = L"Call";
      |                           ^~~~~~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:56:27: warning: unused variable 'CYTO_CALL_NAME' [-Wunused-const-variable]
   56 | const static std::wstring CYTO_CALL_NAME = L"Call";
      |                           ^~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:77:27: warning: unused variable 'COPY_NUMBER_VARIATION_CALL_NAME' [-Wunused-const-variable]
   77 | const static std::wstring COPY_NUMBER_VARIATION_CALL_NAME = L"Call";
      |                           ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:209:27: warning: unused variable 'CN' [-Wunused-const-variable]
  209 | const static std::wstring CN = L"CN";
      |                           ^~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:210:27: warning: unused variable 'LOH' [-Wunused-const-variable]
  210 | const static std::wstring LOH = L"LOH";
      |                           ^~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:220:27: warning: unused variable 'SCAR' [-Wunused-const-variable]
  220 | const static std::wstring SCAR = L"SCAR";
      |                           ^~~~
6 warnings generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPTilingData.cpp -o fusion/calvin_files/data/src/CHPTilingData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationData.cpp -o fusion/calvin_files/data/src/CHPQuantificationData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationDetectionData.cpp -o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPGenotypeEntry.cpp -o fusion/calvin_files/data/src/CHPGenotypeEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPUniversalEntry.cpp -o fusion/calvin_files/data/src/CHPUniversalEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/ColumnInfo.cpp -o fusion/calvin_files/data/src/ColumnInfo.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroup.cpp -o fusion/calvin_files/data/src/DataGroup.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroupHeader.cpp -o fusion/calvin_files/data/src/DataGroupHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSet.cpp -o fusion/calvin_files/data/src/DataSet.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSetHeader.cpp -o fusion/calvin_files/data/src/DataSetHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/FileHeader.cpp -o fusion/calvin_files/data/src/FileHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericData.cpp -o fusion/calvin_files/data/src/GenericData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericDataHeader.cpp -o fusion/calvin_files/data/src/GenericDataHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/exception/src/ExceptionBase.cpp -o fusion/calvin_files/exception/src/ExceptionBase.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionBPMAPData.cpp -o fusion/calvin_files/fusion/src/FusionBPMAPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFData.cpp -o fusion/calvin_files/fusion/src/FusionCDFData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.cpp -o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCELData.cpp -o fusion/calvin_files/fusion/src/FusionCELData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPData.cpp -o fusion/calvin_files/fusion/src/FusionCHPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionProbeSetResults.cpp -o fusion/calvin_files/fusion/src/FusionProbeSetResults.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPLegacyData.cpp -o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataData.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPTilingData.cpp -o fusion/calvin_files/fusion/src/FusionCHPTilingData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPGenericData.cpp -o fusion/calvin_files/fusion/src/FusionCHPGenericData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parameter/src/ParameterNameValueType.cpp -o fusion/calvin_files/parameter/src/ParameterNameValueType.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CDFFileReader.cpp -o fusion/calvin_files/parsers/src/CDFFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CelFileReader.cpp -o fusion/calvin_files/parsers/src/CelFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPFileReader.cpp -o fusion/calvin_files/parsers/src/CHPFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPMultiDataFileReader.cpp -o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPTilingFileReader.cpp -o fusion/calvin_files/parsers/src/CHPTilingFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupReader.cpp -o fusion/calvin_files/parsers/src/DataGroupReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataSetHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetReader.cpp -o fusion/calvin_files/parsers/src/DataSetReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileHeaderReader.cpp -o fusion/calvin_files/parsers/src/FileHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileInput.cpp -o fusion/calvin_files/parsers/src/FileInput.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericDataHeaderReader.cpp -o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericFileReader.cpp -o fusion/calvin_files/parsers/src/GenericFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/AffymetrixGuid.cpp -o fusion/calvin_files/utils/src/AffymetrixGuid.o
fusion/calvin_files/utils/src/AffymetrixGuid.cpp:106:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  106 |         sprintf(guid, "%10d-%10d-%10d-%10d-%10d",
      |         ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
  278 | __deprecated_msg("This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
      | ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
  227 |         #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
      |                                                       ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/DateTime.cpp -o fusion/calvin_files/utils/src/DateTime.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/FileUtils.cpp -o fusion/calvin_files/utils/src/FileUtils.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/StringUtils.cpp -o fusion/calvin_files/utils/src/StringUtils.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/checksum.cpp -o fusion/calvin_files/utils/src/checksum.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/BPMAPFileData.cpp -o fusion/file/BPMAPFileData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/BPMAPFileWriter.cpp -o fusion/file/BPMAPFileWriter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CDFFileData.cpp -o fusion/file/CDFFileData.o
fusion/file/CDFFileData.cpp:1040:7: warning: unused typedef 'TilingTypes' [-Wunused-local-typedef]
 1040 |     } TilingTypes;
      |       ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CELFileData.cpp -o fusion/file/CELFileData.o
fusion/file/CELFileData.cpp:1926:7: warning: variable 'iCell' set but not used [-Wunused-but-set-variable]
 1926 |                 int iCell=0;
      |                     ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/CHPFileData.cpp -o fusion/file/CHPFileData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/FileIO.cpp -o fusion/file/FileIO.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/FileWriter.cpp -o fusion/file/FileWriter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/ClfFile.cpp -o fusion/file/TsvFile/ClfFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/PgfFile.cpp -o fusion/file/TsvFile/PgfFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/file/TsvFile/TsvFile.cpp -o fusion/file/TsvFile/TsvFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/AffxByteArray.cpp -o fusion/util/AffxByteArray.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/AffxConv.cpp -o fusion/util/AffxConv.o
fusion/util/AffxConv.cpp:122:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  122 |         sprintf(szValue, "%d", i);
      |         ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
  278 | __deprecated_msg("This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
      | ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
  227 |         #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
      |                                                       ^
fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
  124 |         if (i != i) {return "nan";}
      |               ^
fusion/util/AffxConv.cpp:178:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  178 |         sprintf(szValue, "%u", i);
      |         ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
  278 | __deprecated_msg("This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
      | ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
  227 |         #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
      |                                                       ^
fusion/util/AffxConv.cpp:200:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  200 |         sprintf(szValue, "%.16g", d);
      |         ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
  278 | __deprecated_msg("This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
      | ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
  227 |         #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
      |                                                       ^
fusion/util/AffxConv.cpp:224:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
  224 |         sprintf(szValue, "%.16g", d);
      |         ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
  278 | __deprecated_msg("This function is provided for compatibility reasons only.  Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
      | ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
  227 |         #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
      |                                                       ^
5 warnings generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/MsgStream.cpp -o fusion/util/MsgStream.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Util.cpp -o fusion/util/Util.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Err.cpp -o fusion/util/Err.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Fs.cpp -o fusion/util/Fs.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Verbose.cpp -o fusion/util/Verbose.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/RowFile.cpp -o fusion/util/RowFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/TableFile.cpp -o fusion/util/TableFile.o
In file included from fusion/util/TableFile.cpp:28:
fusion/util/TableFile.h:231:8: warning: private field 'm_Comment' is not used [-Wunused-private-field]
  231 |   char m_Comment;            ///< Comment character for data.
      |        ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c fusion/util/Convert.cpp -o fusion/util/Convert.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cel_parser.cpp -o R_affx_cel_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cdf_parser.cpp -o R_affx_cdf_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_cdf_extras.cpp -o R_affx_cdf_extras.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_bpmap_parser.cpp -o R_affx_bpmap_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_clf_pgf_parser.cpp -o R_affx_clf_pgf_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -Wno-sign-compare -O0 -c R_affx_chp_parser.cpp -o R_affx_chp_parser.o
clang -arch arm64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_  -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c 000.init.c -o 000.init.o
clang++ -arch arm64 -std=gnu++20 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o affxparser.so fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o -F/Library/Frameworks/R.framework/.. -framework R
installing to /Library/Frameworks/R.framework/Versions/4.6/Resources/library/00LOCK-affxparser/00new/affxparser/libs
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (affxparser)

Tests output

affxparser.Rcheck/tests/convertCel.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   ## rawData/
+   pathR <- system.file(package="AffymetrixDataTestFiles", mustWork=TRUE)
+   pathR <- file.path(pathR, "rawData")
+ 
+   ## File #1: Test3
+   chipType <- "Test3"
+   path <- file.path(pathR, "FusionSDK_Test3", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+ 
+ 
+   ## File #2: FusionSDK_HG-U133A
+   chipType <- "HG-U133A"
+   path <- file.path(pathR, "FusionSDK_HG-U133A", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == newChipType)
+ 
+ 
+   ## File #3: FusionSDK_Focus
+   chipType <- "HG-Focus"
+   path <- file.path(pathR, "FusionSDK_HG-Focus", chipType, "2.Calvin")
+   filename <- list.files(path=path, pattern="[.]CEL$")[1]
+   pathname <- file.path(path, filename)
+   hdr <- readCelHeader(pathname)
+   str(hdr)
+   stopifnot(hdr$chiptype == chipType)
+   filename4 <- gsub(".CEL", ",v4.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+   stopifnot(hdr4$chiptype == hdr$chiptype)
+ 
+   ## New chip type
+   newChipType <- sprintf("%s-custom", chipType)
+   filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+   pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+   print(pathname4)
+   hdr4 <- readCelHeader(pathname4)
+   str(hdr4)
+ ##  FIXME
+ ##  stopifnot(hdr4$chiptype == newChipType)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
 $ version       : int 1
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr ""
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL
  CEL 2: ./Test3-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./Test3-1-121502,v4.CEL"
List of 14
 $ filename      : chr "./Test3-1-121502,v4.CEL"
 $ version       : int 4
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'Test3' to 'Test3-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./Test3-1-121502,v4,custom.CEL"
List of 14
 $ filename      : chr "./Test3-1-121502,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 126
 $ rows          : int 126
 $ total         : int 15876
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
 $ chiptype      : chr "Test3"
 $ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
 $ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 5
 $ nmasked       : int 0
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U13"| __truncated__
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U133A/HG-U133A/2.Calvin/ethan1-1.CEL
  CEL 2: ./ethan1-1,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./ethan1-1,v4.CEL"
List of 14
 $ filename      : chr "./ethan1-1,v4.CEL"
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-U133A' to 'HG-U133A-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./ethan1-1,v4,custom.CEL"
List of 14
 $ filename      : chr "./ethan1-1,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 712
 $ rows          : int 712
 $ total         : int 506944
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
 $ chiptype      : chr "HG-U133A-custom"
 $ header        : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
 $ datheader     : chr "[46..48458]  ethan1-1:CLS=5377 RWS=5377 XIN=2  YIN=2  VE=30        2.0 11/10/04 18:23:42 M10SIM  M10   \024  \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 2085
 $ nmasked       : int 0
List of 14
 $ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Foc"| __truncated__
 $ version       : int 1
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr ""
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
  CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Focus/HG-Focus/2.Calvin/HG-Focus-1-121502.CEL
  CEL 2: ./HG-Focus-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
  Comparing CEL headers...
  Comparing CEL headers...done
  Comparing CEL data...
  Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./HG-Focus-1-121502,v4.CEL"
List of 14
 $ filename      : chr "./HG-Focus-1-121502,v4.CEL"
 $ version       : int 4
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-Focus' to 'HG-Focus-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./HG-Focus-1-121502,v4,custom.CEL"
List of 14
 $ filename      : chr "./HG-Focus-1-121502,v4,custom.CEL"
 $ version       : int 4
 $ cols          : int 448
 $ rows          : int 448
 $ total         : int 200704
 $ algorithm     : chr "Percentile"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
 $ chiptype      : chr "HG-Focus"
 $ header        : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
 $ datheader     : chr "[7..46138]  B1:CLS=2920 RWS=2920 XIN=3  YIN=3  VE=17        2.0 05/15/02 11:07:10    \024  \024 HG-Focus.1sq \0"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 508
 $ nmasked       : int 0
> 
> proc.time()
   user  system elapsed 
  0.861   0.078   0.945 

affxparser.Rcheck/tests/readCdfDataFrame.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfDataFrame(cdf)
+   str(data)
+   stopifnot(length(unique(data$unitName)) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfDataFrame() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfDataFrame(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfDataFrame(cdf, units=idxs)
+       str(data)
+       units <- if (is.null(idxs)) seq_len(Jall) else as.integer(idxs)
+       stopifnot(length(unique(data$unitName)) == length(units))
+       stopifnot(identical(sort(unique(data$unit)), units))
+     }
+     message(sprintf("Testing readCdfDataFrame() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
'data.frame':	12708 obs. of  16 variables:
 $ unit           : int  1 1 1 1 1 1 1 1 1 1 ...
 $ unitName       : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ unitNbrOfAtoms : int  16 16 16 16 16 16 16 16 16 16 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ groupDirection : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ groupNbrOfAtoms: int  16 16 16 16 16 16 16 16 16 16 ...
 $ cell           : int  10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ x              : int  111 111 19 19 95 95 18 18 25 25 ...
 $ y              : int  79 80 19 20 39 40 55 56 113 114 ...
 $ pbase          : chr  "t" "a" "a" "t" ...
 $ tbase          : chr  "a" "a" "t" "t" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...
List of 1
 $ idxs: NULL
'data.frame':	12708 obs. of  16 variables:
 $ unit           : int  1 1 1 1 1 1 1 1 1 1 ...
 $ unitName       : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ unitNbrOfAtoms : int  16 16 16 16 16 16 16 16 16 16 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
 $ groupDirection : chr  "antisense" "antisense" "antisense" "antisense" ...
 $ groupNbrOfAtoms: int  16 16 16 16 16 16 16 16 16 16 ...
 $ cell           : int  10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ x              : int  111 111 19 19 95 95 18 18 25 25 ...
 $ y              : int  79 80 19 20 39 40 55 56 113 114 ...
 $ pbase          : chr  "t" "a" "a" "t" ...
 $ tbase          : chr  "a" "a" "t" "t" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...done
Testing readCdfDataFrame() with 'readOne' indices...
List of 1
 $ idxs: int 10
'data.frame':	24 obs. of  16 variables:
 $ unit           : int  10 10 10 10 10 10 10 10 10 10 ...
 $ unitName       : chr  "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
 $ x              : int  37 37 79 79 68 68 51 51 79 79 ...
 $ y              : int  33 34 67 68 65 66 111 112 43 44 ...
 $ pbase          : chr  "t" "a" "c" "g" ...
 $ tbase          : chr  "a" "a" "g" "g" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readOne' indices...done
Testing readCdfDataFrame() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame':	288 obs. of  16 variables:
 $ unit           : int  11 11 11 11 11 11 11 11 11 11 ...
 $ unitName       : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ x              : int  15 15 35 35 83 83 113 113 119 119 ...
 $ y              : int  45 46 57 58 55 56 17 18 65 66 ...
 $ pbase          : chr  "t" "a" "t" "a" ...
 $ tbase          : chr  "a" "a" "a" "a" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readSome' indices...done
Testing readCdfDataFrame() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame':	288 obs. of  16 variables:
 $ unit           : int  11 11 11 11 11 11 11 11 11 11 ...
 $ unitName       : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ unitType       : chr  "expression" "expression" "expression" "expression" ...
 $ unitDirection  : chr  "sense" "sense" "sense" "sense" ...
 $ unitNbrOfAtoms : int  12 12 12 12 12 12 12 12 12 12 ...
 $ group          : int  1 1 1 1 1 1 1 1 1 1 ...
 $ groupName      : chr  "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
 $ groupDirection : chr  "sense" "sense" "sense" "sense" ...
 $ groupNbrOfAtoms: int  12 12 12 12 12 12 12 12 12 12 ...
 $ cell           : int  5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ x              : int  15 15 35 35 83 83 113 113 119 119 ...
 $ y              : int  45 46 57 58 55 56 17 18 65 66 ...
 $ pbase          : chr  "t" "a" "t" "a" ...
 $ tbase          : chr  "a" "a" "a" "a" ...
 $ indexPos       : int  0 0 1 1 2 2 3 3 4 4 ...
 $ atom           : int  0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readDouble' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCdfDataFrame(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCdfDataFrame(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,345]: 1000000000"
 $ call   : language readCdf(filename, units = units, readXY = readXY, readBases = readBases,      readIndexpos = readIndexpos, readAt| __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Warning messages:
1: In readCdfDataFrame(cdf) : Some of the fields were not read: expos
2: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
3: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
4: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
5: In readCdfDataFrame(cdf, units = idxs) :
  Some of the fields were not read: expos
> 
> proc.time()
   user  system elapsed 
  0.610   0.040   0.644 

affxparser.Rcheck/tests/readCdfQc.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nqcunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=5L,
+     readSome=5:10,
+     readDouble=as.double(5:10),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfQc(cdf)
+   str(head(data))
+   stopifnot(length(data) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfQc() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfQc(cdf, units=idxs)
+       str(head(data))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data) == J)
+     }
+     message(sprintf("Testing readCdfQc() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
  ..$ indices   : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpNegative"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
  ..$ indices   : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpPositive"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ y         : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
  ..$ length    : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybeNegative"
  ..$ ncells    : int 204
 $ :List of 8
  ..$ x         : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
  ..$ y         : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
  ..$ indices   : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardPositive"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
Testing readCdfQc() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
  ..$ indices   : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpNegative"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
  ..$ y         : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
  ..$ indices   : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
  ..$ length    : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
  ..$ pm        : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
  ..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
  ..$ type      : chr "geneExpPositive"
  ..$ ncells    : int 300
 $ :List of 8
  ..$ x         : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ y         : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
  ..$ length    : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybeNegative"
  ..$ ncells    : int 204
 $ :List of 8
  ..$ x         : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
  ..$ y         : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
  ..$ indices   : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardPositive"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
Testing readCdfQc() with 'readAll' indices...done
Testing readCdfQc() with 'readOne' indices...
List of 1
 $ idxs: int 5
List of 1
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
Testing readCdfQc() with 'readOne' indices...done
Testing readCdfQc() with 'readSome' indices...
List of 1
 $ idxs: int [1:6] 5 6 7 8 9 10
List of 6
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
 $ :List of 8
  ..$ x         : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
  ..$ y         : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
  ..$ indices   : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
  ..$ length    : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybePositive"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
  ..$ y         : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
  ..$ indices   : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
  ..$ length    : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybeNegative"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
  ..$ y         : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
  ..$ length    : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesPositive"
  ..$ ncells    : int 294
 $ :List of 8
  ..$ x         : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
  ..$ y         : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
  ..$ length    : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesNegative"
  ..$ ncells    : int 161
Testing readCdfQc() with 'readSome' indices...done
Testing readCdfQc() with 'readDouble' indices...
List of 1
 $ idxs: num [1:6] 5 6 7 8 9 10
List of 6
 $ :List of 8
  ..$ x         : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
  ..$ y         : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
  ..$ indices   : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
  ..$ length    : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "checkerboardNegative"
  ..$ ncells    : int 32
 $ :List of 8
  ..$ x         : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
  ..$ y         : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
  ..$ indices   : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
  ..$ length    : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "crossHybePositive"
  ..$ ncells    : int 208
 $ :List of 8
  ..$ x         : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
  ..$ y         : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
  ..$ indices   : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
  ..$ length    : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybePositive"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
  ..$ y         : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
  ..$ indices   : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
  ..$ length    : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
  ..$ pm        : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "hybeNegative"
  ..$ ncells    : int 24
 $ :List of 8
  ..$ x         : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
  ..$ y         : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
  ..$ length    : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesPositive"
  ..$ ncells    : int 294
 $ :List of 8
  ..$ x         : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
  ..$ y         : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
  ..$ indices   : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
  ..$ length    : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
  ..$ pm        : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
  ..$ type      : chr "textFeaturesNegative"
  ..$ ncells    : int 161
Testing readCdfQc() with 'readDouble' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.143   0.034   0.175 

affxparser.Rcheck/tests/readCdfUnits_etal.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   fcnNames <- c(
+     "readCdf",
+     "readCdfUnits",
+     "readCdfUnitNames",
+     "readCdfNbrOfCellsPerUnitGroup",
+     "readCdfGroupNames",
+     "readCdfCellIndices",
+     "readCdfIsPm"
+   )
+ 
+   # Read full file
+   for (fcnName in fcnNames) {
+     fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+     data <- fcn(cdf)
+     str(head(data))
+     stopifnot(length(data) == Jall)
+   } # for (fcn ...)
+ 
+   for (fcnName in fcnNames) {
+     fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+ 
+     # Read different subsets of units
+     for (ii in seq_along(idxsList)) {
+       name <- names(idxsList)[ii]
+       message(sprintf("Testing %s() with '%s' indices...", fcnName, name))
+       idxs <- idxsList[[ii]]
+       str(list(idxs=idxs))
+       if (grepl("outOfRange", name)) {
+         res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+         str(res)
+         stopifnot(inherits(res, "error"))
+       } else {
+         data <- fcn(cdf, units=idxs)
+         str(head(data))
+         J <- if (is.null(idxs)) Jall else length(idxs)
+         stopifnot(length(data) == J)
+       }
+       message(sprintf("Testing %s() with '%s' indices...done", fcnName, name))
+     } # for (ii ...)
+   } # for (fcn ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ Pae_16SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y             : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase         : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1000
 $ Pae_23SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y             : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1001
 $ PA1178_oprH_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_at:List of 9
  .. .. ..$ x             : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y             : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1002
 $ PA1816_dnaQ_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_at:List of 9
  .. .. ..$ x             : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y             : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1003
 $ PA3183_zwf_at   :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_at:List of 9
  .. .. ..$ x             : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y             : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1004
 $ PA3640_dnaE_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_at:List of 9
  .. .. ..$ x             : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y             : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1005
List of 6
 $ Pae_16SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y        : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase    : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ Pae_23SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y        : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1178_oprH_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_at:List of 6
  .. .. ..$ x        : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y        : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1816_dnaQ_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_at:List of 6
  .. .. ..$ x        : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y        : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3183_zwf_at   :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_at:List of 6
  .. .. ..$ x        : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y        : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3640_dnaE_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_at:List of 6
  .. .. ..$ x        : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y        : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
List of 6
 $ Pae_16SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
 $ Pae_23SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
 $ PA1178_oprH_at  : Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_at"
 $ PA1816_dnaQ_at  : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_at"
 $ PA3183_zwf_at   : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_at"
 $ PA3640_dnaE_at  : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_at"
List of 6
 $ Pae_16SrRNA_s_at: chr ""
 $ Pae_23SrRNA_s_at: chr ""
 $ PA1178_oprH_at  : chr ""
 $ PA1816_dnaQ_at  : chr ""
 $ PA3183_zwf_at   : chr ""
 $ PA3640_dnaE_at  : chr ""
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
 $ PA1178_oprH_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_at:List of 1
  .. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_at:List of 1
  .. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
 $ PA3183_zwf_at   :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_at:List of 1
  .. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_at:List of 1
  .. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdf() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y             : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase         : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1000
 $ Pae_23SrRNA_s_at:List of 7
  ..$ groups       :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 9
  .. .. ..$ x             : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y             : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1001
 $ PA1178_oprH_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_at:List of 9
  .. .. ..$ x             : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y             : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1002
 $ PA1816_dnaQ_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_at:List of 9
  .. .. ..$ x             : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y             : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1003
 $ PA3183_zwf_at   :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_at:List of 9
  .. .. ..$ x             : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y             : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1004
 $ PA3640_dnaE_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_at:List of 9
  .. .. ..$ x             : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y             : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1005
Testing readCdf() with 'readAll' indices...done
Testing readCdf() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 7
  ..$ groups       :List of 1
  .. ..$ PA1178_oprH_st:List of 9
  .. .. ..$ x             : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
  .. .. ..$ y             : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "c" "g" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "g" "g" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1052
Testing readCdf() with 'readOne' indices...done
Testing readCdf() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_st:List of 9
  .. .. ..$ x             : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y             : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1053
 $ PA3183_zwf_st          :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_st:List of 9
  .. .. ..$ x             : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y             : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1054
 $ PA3640_dnaE_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_st:List of 9
  .. .. ..$ x             : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y             : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1055
 $ PA4407_ftsZ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA4407_ftsZ_st:List of 9
  .. .. ..$ x             : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y             : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase         : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1056
 $ AFFX-Athal-Actin_5_r_at:List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 9
  .. .. ..$ x             : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y             : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase         : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1100
 $ AFFX-Athal-Actin_M_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 9
  .. .. ..$ x             : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y             : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1101
Testing readCdf() with 'readSome' indices...done
Testing readCdf() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA1816_dnaQ_st:List of 9
  .. .. ..$ x             : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y             : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1053
 $ PA3183_zwf_st          :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3183_zwf_st:List of 9
  .. .. ..$ x             : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y             : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase         : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1054
 $ PA3640_dnaE_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA3640_dnaE_st:List of 9
  .. .. ..$ x             : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y             : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase         : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1055
 $ PA4407_ftsZ_st         :List of 7
  ..$ groups       :List of 1
  .. ..$ PA4407_ftsZ_st:List of 9
  .. .. ..$ x             : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y             : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase         : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase         : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ atom          : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "sense"
  .. .. ..$ natoms        : int 12
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "sense"
  ..$ natoms       : int 12
  ..$ ncells       : int 24
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1056
 $ AFFX-Athal-Actin_5_r_at:List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 9
  .. .. ..$ x             : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y             : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase         : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1100
 $ AFFX-Athal-Actin_M_at  :List of 7
  ..$ groups       :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 9
  .. .. ..$ x             : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y             : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase         : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase         : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ atom          : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ indexpos      : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ groupdirection: chr "antisense"
  .. .. ..$ natoms        : int 16
  .. .. ..$ ncellsperatom : int 2
  ..$ unittype     : chr "expression"
  ..$ unitdirection: chr "antisense"
  ..$ natoms       : int 16
  ..$ ncells       : int 32
  ..$ ncellsperatom: int 2
  ..$ unitnumber   : int 1101
Testing readCdf() with 'readDouble' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdfUnits() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
  .. .. ..$ y        : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
  .. .. ..$ pbase    : chr [1:32] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:32] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ Pae_23SrRNA_s_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 6
  .. .. ..$ x        : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
  .. .. ..$ y        : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1178_oprH_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_at:List of 6
  .. .. ..$ x        : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
  .. .. ..$ y        : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "g" "c" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "c" "c" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA1816_dnaQ_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_at:List of 6
  .. .. ..$ x        : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
  .. .. ..$ y        : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3183_zwf_at   :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_at:List of 6
  .. .. ..$ x        : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
  .. .. ..$ y        : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ PA3640_dnaE_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_at:List of 6
  .. .. ..$ x        : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
  .. .. ..$ y        : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "a" "t" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "t" "t" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readAll' indices...done
Testing readCdfUnits() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1178_oprH_st:List of 6
  .. .. ..$ x        : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
  .. .. ..$ y        : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "c" "g" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "g" "g" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
Testing readCdfUnits() with 'readOne' indices...done
Testing readCdfUnits() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_st:List of 6
  .. .. ..$ x        : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y        : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3183_zwf_st          :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_st:List of 6
  .. .. ..$ x        : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y        : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3640_dnaE_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_st:List of 6
  .. .. ..$ x        : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y        : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA4407_ftsZ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA4407_ftsZ_st:List of 6
  .. .. ..$ x        : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y        : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase    : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ AFFX-Athal-Actin_5_r_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 6
  .. .. ..$ x        : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y        : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase    : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ AFFX-Athal-Actin_M_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 6
  .. .. ..$ x        : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y        : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readSome' indices...done
Testing readCdfUnits() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA1816_dnaQ_st:List of 6
  .. .. ..$ x        : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
  .. .. ..$ y        : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3183_zwf_st          :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3183_zwf_st:List of 6
  .. .. ..$ x        : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
  .. .. ..$ y        : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
  .. .. ..$ pbase    : chr [1:24] "a" "t" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "t" "t" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA3640_dnaE_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA3640_dnaE_st:List of 6
  .. .. ..$ x        : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
  .. .. ..$ y        : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
  .. .. ..$ pbase    : chr [1:24] "t" "a" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "a" "a" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ PA4407_ftsZ_st         :List of 3
  ..$ type     : int 1
  ..$ direction: int 1
  ..$ groups   :List of 1
  .. ..$ PA4407_ftsZ_st:List of 6
  .. .. ..$ x        : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
  .. .. ..$ y        : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
  .. .. ..$ pbase    : chr [1:24] "g" "c" "t" "a" ...
  .. .. ..$ tbase    : chr [1:24] "c" "c" "a" "a" ...
  .. .. ..$ expos    : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 1
 $ AFFX-Athal-Actin_5_r_at:List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 6
  .. .. ..$ x        : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
  .. .. ..$ y        : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
  .. .. ..$ pbase    : chr [1:32] "c" "g" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "g" "g" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
 $ AFFX-Athal-Actin_M_at  :List of 3
  ..$ type     : int 1
  ..$ direction: int 2
  ..$ groups   :List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 6
  .. .. ..$ x        : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
  .. .. ..$ y        : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
  .. .. ..$ pbase    : chr [1:32] "a" "t" "c" "g" ...
  .. .. ..$ tbase    : chr [1:32] "t" "t" "g" "g" ...
  .. .. ..$ expos    : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
  .. .. ..$ direction: int 2
Testing readCdfUnits() with 'readDouble' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'readAll' indices...
List of 1
 $ idxs: NULL
 chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
Testing readCdfUnitNames() with 'readAll' indices...done
Testing readCdfUnitNames() with 'readOne' indices...
List of 1
 $ idxs: int 10
 chr "PA1178_oprH_st"
Testing readCdfUnitNames() with 'readOne' indices...done
Testing readCdfUnitNames() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readSome' indices...done
Testing readCdfUnitNames() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readDouble' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
 $ Pae_23SrRNA_s_at: Named int 32
  ..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
 $ PA1178_oprH_at  : Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_at"
 $ PA1816_dnaQ_at  : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_at"
 $ PA3183_zwf_at   : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_at"
 $ PA3640_dnaE_at  : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st: Named int 24
  ..- attr(*, "names")= chr "PA1178_oprH_st"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_st"
 $ PA3183_zwf_st          : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_st"
 $ PA3640_dnaE_st         : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_st"
 $ PA4407_ftsZ_st         : Named int 24
  ..- attr(*, "names")= chr "PA4407_ftsZ_st"
 $ AFFX-Athal-Actin_5_r_at: Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
 $ AFFX-Athal-Actin_M_at  : Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : Named int 24
  ..- attr(*, "names")= chr "PA1816_dnaQ_st"
 $ PA3183_zwf_st          : Named int 24
  ..- attr(*, "names")= chr "PA3183_zwf_st"
 $ PA3640_dnaE_st         : Named int 24
  ..- attr(*, "names")= chr "PA3640_dnaE_st"
 $ PA4407_ftsZ_st         : Named int 24
  ..- attr(*, "names")= chr "PA4407_ftsZ_st"
 $ AFFX-Athal-Actin_5_r_at: Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
 $ AFFX-Athal-Actin_M_at  : Named int 32
  ..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at: chr ""
 $ Pae_23SrRNA_s_at: chr ""
 $ PA1178_oprH_at  : chr ""
 $ PA1816_dnaQ_at  : chr ""
 $ PA3183_zwf_at   : chr ""
 $ PA3640_dnaE_at  : chr ""
Testing readCdfGroupNames() with 'readAll' indices...done
Testing readCdfGroupNames() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st: chr ""
Testing readCdfGroupNames() with 'readOne' indices...done
Testing readCdfGroupNames() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : chr ""
 $ PA3183_zwf_st          : chr ""
 $ PA3640_dnaE_st         : chr ""
 $ PA4407_ftsZ_st         : chr ""
 $ AFFX-Athal-Actin_5_r_at: chr ""
 $ AFFX-Athal-Actin_M_at  : chr ""
Testing readCdfGroupNames() with 'readSome' indices...done
Testing readCdfGroupNames() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         : chr ""
 $ PA3183_zwf_st          : chr ""
 $ PA3640_dnaE_st         : chr ""
 $ PA4407_ftsZ_st         : chr ""
 $ AFFX-Athal-Actin_5_r_at: chr ""
 $ AFFX-Athal-Actin_M_at  : chr ""
Testing readCdfGroupNames() with 'readDouble' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_16SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ groups:List of 1
  .. ..$ Pae_23SrRNA_s_at:List of 1
  .. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
 $ PA1178_oprH_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_at:List of 1
  .. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_at:List of 1
  .. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
 $ PA3183_zwf_at   :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_at:List of 1
  .. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_at:List of 1
  .. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
Testing readCdfCellIndices() with 'readAll' indices...done
Testing readCdfCellIndices() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ groups:List of 1
  .. ..$ PA1178_oprH_st:List of 1
  .. .. ..$ indices: int [1:24] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfCellIndices() with 'readOne' indices...done
Testing readCdfCellIndices() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_st:List of 1
  .. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ PA3183_zwf_st          :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_st:List of 1
  .. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_st:List of 1
  .. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA4407_ftsZ_st:List of 1
  .. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 1
  .. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readSome' indices...done
Testing readCdfCellIndices() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA1816_dnaQ_st:List of 1
  .. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
 $ PA3183_zwf_st          :List of 1
  ..$ groups:List of 1
  .. ..$ PA3183_zwf_st:List of 1
  .. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA3640_dnaE_st:List of 1
  .. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ groups:List of 1
  .. ..$ PA4407_ftsZ_st:List of 1
  .. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ groups:List of 1
  .. ..$ AFFX-Athal-Actin_M_at:List of 1
  .. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readDouble' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readAll' indices...done
Testing readCdfIsPm() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ PA1178_oprH_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readOne' indices...done
Testing readCdfIsPm() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readSome' indices...done
Testing readCdfIsPm() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readDouble' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
 $ call   : language readCdfQc(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.314   0.077   0.394 

affxparser.Rcheck/tests/readCdfUnitsWriteMap.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCdfUnitsWriteMap(cdf)
+   str(data)
+   Jall <- length(data)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCdfUnitsWriteMap(cdf, units=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCdfUnitsWriteMap(cdf, units=idxs)
+       str(data)
+       stopifnot(length(data) == Jall)
+     }
+     message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
 int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...
List of 1
 $ idxs: NULL
 int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...done
Testing readCdfUnitsWriteMap() with 'readOne' indices...
List of 1
 $ idxs: int 10
 int [1:15876] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfUnitsWriteMap() with 'readOne' indices...done
Testing readCdfUnitsWriteMap() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readSome' indices...done
Testing readCdfUnitsWriteMap() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readDouble' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices: -1"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices: 0"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains indices out of range [1,345]: 1e+09"
 $ call   : language readCdfUnitsWriteMap(cdf, units = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.116   0.035   0.146 

affxparser.Rcheck/tests/readCel.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Find all CEL files
+   cels <- list.files(path=pathD, pattern="[.]CEL$",
+                      recursive=TRUE, full.names=TRUE)
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ #    readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   for (kk in seq_along(cels)) {
+     cel <- cels[kk]
+ 
+     # Read full file
+     data <- readCel(cel)
+     str(data)
+     Jall <- data$header$total
+     stopifnot(length(data$intensities) == Jall)
+ 
+     # Read different subsets of cells
+     for (ii in seq_along(idxsList)) {
+       name <- names(idxsList)[ii]
+       message(sprintf("Testing readCel() with '%s' indices...", name))
+       idxs <- idxsList[[ii]]
+       str(list(idxs=idxs))
+       if (grepl("outOfRange", name)) {
+         res <- tryCatch(readCel(cel, indices=idxs), error=function(ex) ex)
+         str(res)
+         stopifnot(inherits(res, "error"))
+       } else {
+         data <- readCel(cel, indices=idxs)
+         str(data)
+         J <- if (is.null(idxs)) Jall else length(idxs)
+         stopifnot(length(data$intensities) == J)
+       }
+       message(sprintf("Testing readCel() with '%s' indices...done", name))
+     } # for (ii ...)
+   } # for (kk ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num 143
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num 136
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 1
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr ""
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 190 11263 164 11272 181 ...
 $ outliers   : int [1:5] 1585 9833 10307 14227 14426
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num 143
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
  ..$ datheader     : chr "[12..40151]  Fetal 3:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:28:31    \024  \024 Test3.1sq"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 5
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 11053 161 11466 152 11210 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
 $ outliers   : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
 $ masked     : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num 136
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
  ..$ version       : int 3
  ..$ cols          : int 126
  ..$ rows          : int 126
  ..$ total         : int 15876
  ..$ algorithm     : chr "Percentile"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
  ..$ chiptype      : chr "Test3"
  ..$ header        : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
  ..$ datheader     : chr "[6..38103]  Fetal 5:CLS=1167 RWS=1167 XIN=3  YIN=3  VE=17        2.0 08/16/01 17:32:06    \024  \024 Test3.1sq "| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 45
  ..$ nmasked       : int 0
 $ intensities: num [1:10] 9044 121 10406 180 11062 ...
 $ outliers   : NULL
 $ masked     : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(cel, indices = idxs)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.350   0.059   0.408 

affxparser.Rcheck/tests/readCelIntensities.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Find all CEL files
+   path <- file.path(pathD, "2.Calvin")
+   cels <- list.files(path=path, pattern="[.]CEL$", full.names=TRUE)
+ 
+   hdr <- readCelHeader(cels[1L])
+   I <- length(cels)
+   Jall <- hdr$total
+ 
+   # Read full file
+   data <- readCelIntensities(cels)
+   str(data)
+   stopifnot(all(dim(data) == c(Jall,I)))
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ #  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read different subsets of cells
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCelIntensities() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCelIntensities(cels, indices=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCelIntensities(cels, indices=idxs)
+       str(data)
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(all(dim(data) == c(J,I)))
+     }
+     message(sprintf("Testing readCelIntensities() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
 num [1:15876, 1:2] 190 11263 164 11272 181 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readAll' indices...
List of 1
 $ idxs: NULL
 num [1:15876, 1:2] 190 11263 164 11272 181 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readAll' indices...done
Testing readCelIntensities() with 'readOne' indices...
List of 1
 $ idxs: int 10
 num [1, 1:2] 143 136
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readOne' indices...done
Testing readCelIntensities() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
 num [1:10, 1:2] 11053 161 11466 152 11210 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readSome' indices...done
Testing readCelIntensities() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
 num [1:10, 1:2] 11053 161 11466 152 11210 ...
 - attr(*, "dimnames")=List of 2
  ..$ : NULL
  ..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readDouble' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' is out of range [1,15876]."
 $ call   : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE,      readHeader = FALSE, readStdvs = | __truncated__ ...
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.134   0.035   0.164 

affxparser.Rcheck/tests/readCelRectangle.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   rotate270 <- function(x, ...) {
+     x <- t(x)
+     nc <- ncol(x)
+     if (nc < 2) return(x)
+     x[,nc:1,drop=FALSE]
+   }
+ 
+   # Search for some available CEL files
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_HG-Focus", "HG-Focus")
+   cel <- file.path(pathD, "2.Calvin", "HG-Focus-1-121502.CEL")
+ 
+   # Read CEL intensities in the upper left corner
+   range <- c(0,250)
+   data <- readCelRectangle(cel, xrange=range, yrange=range)
+ 
+   # Displaying image
+   z <- rotate270(data$intensities)
+   sub <- sprintf("Chip type: %s", data$header$chiptype)
+   image(z, col=gray.colors(256), axes=FALSE, main=basename(cel), sub=sub)
+   text(x=0, y=1, labels="(0,0)", adj=c(0,-0.7), cex=0.8, xpd=TRUE)
+   text(x=1, y=0, labels="(250,250)", adj=c(1,1.2), cex=0.8, xpd=TRUE)
+ 
+   # Read 1x1 rectangle
+   range <- c(0,0)
+   data <- readCelRectangle(cel, xrange=range, yrange=range)
+   print(data$intensities)
+   stopifnot(all(dim(data$intensities) == c(1,1)))
+ }
Loading required package: AffymetrixDataTestFiles
     [,1]
[1,] 83.3
> 
> 
> 
> proc.time()
   user  system elapsed 
  0.203   0.046   0.244 

affxparser.Rcheck/tests/readCelUnits.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles")) {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+   pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+ 
+   # Read CDF structure
+   cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+   hdr <- readCdfHeader(cdf)
+   Jall <- hdr$nunits
+ 
+   # Find all CEL files
+   cels <- list.files(path=pathD, pattern="[.]CEL$",
+                           recursive=TRUE, full.names=TRUE)
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##  readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=10L,
+     readSome=11:20,
+     readDouble=as.double(11:20),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   # Read full file
+   data <- readCelUnits(cels, cdf=cdf)
+   str(head(data))
+   stopifnot(length(data) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readCelUnits() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readCelUnits(cels, units=idxs, cdf=cdf), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readCelUnits(cels, units=idxs, cdf=cdf)
+       str(head(data))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data) == J)
+     }
+     message(sprintf("Testing readCelUnits() with '%s' indices...done", name))
+   } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ Pae_16SrRNA_s_at:List of 1
  ..$ Pae_16SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
 $ Pae_23SrRNA_s_at:List of 1
  ..$ Pae_23SrRNA_s_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
 $ PA1178_oprH_at  :List of 1
  ..$ PA1178_oprH_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
 $ PA1816_dnaQ_at  :List of 1
  ..$ PA1816_dnaQ_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
 $ PA3183_zwf_at   :List of 1
  ..$ PA3183_zwf_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
 $ PA3640_dnaE_at  :List of 1
  ..$ PA3640_dnaE_at:List of 1
  .. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...done
Testing readCelUnits() with 'readOne' indices...
List of 1
 $ idxs: int 10
List of 1
 $ PA1178_oprH_st:List of 1
  ..$ PA1178_oprH_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 119 142 139 170 ...
Testing readCelUnits() with 'readOne' indices...done
Testing readCelUnits() with 'readSome' indices...
List of 1
 $ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readSome' indices...done
Testing readCelUnits() with 'readDouble' indices...
List of 1
 $ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
 $ PA1816_dnaQ_st         :List of 1
  ..$ PA1816_dnaQ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
 $ PA3183_zwf_st          :List of 1
  ..$ PA3183_zwf_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
 $ PA3640_dnaE_st         :List of 1
  ..$ PA3640_dnaE_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
 $ PA4407_ftsZ_st         :List of 1
  ..$ PA4407_ftsZ_st:List of 1
  .. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
 $ AFFX-Athal-Actin_5_r_at:List of 1
  ..$ AFFX-Athal-Actin_5_r_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
 $ AFFX-Athal-Actin_M_at  :List of 1
  ..$ AFFX-Athal-Actin_M_at:List of 1
  .. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readDouble' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCelUnits(cels, units = idxs, cdf = cdf)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'units' contains non-positive indices."
 $ call   : language readCelUnits(cels, units = idxs, cdf = cdf)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'units' contains an element out of range: 1000000000"
 $ call   : language readCdfCellIndices(cdfFile, units = units, stratifyBy = stratifyBy, verbose = FALSE)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.194   0.044   0.237 

affxparser.Rcheck/tests/readPgf.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> if (require("AffymetrixDataTestFiles") && packageVersion("AffymetrixDataTestFiles") >= "0.4.0") {
+   library("affxparser")
+ 
+   pathR <- system.file(package="AffymetrixDataTestFiles")
+   pathA <- file.path(pathR, "annotationData", "chipTypes", "HuGene-1_0-st-v1")
+ 
+   # Read PGF structure
+   pgf <- file.path(pathA, "HuGene-1_0-st-v1.r4,10_probesets.pgf")
+ 
+   # NOTE: Hard-coded
+   Jall <- 10L
+ 
+   # Various sets of indices to be read
+   idxsList <- list(
+ ##    readNothing=integer(0L), # FIX ME
+     readAll=NULL,
+     readOne=5L,
+     readSome=1:5,
+     readDouble=as.double(1:5),
+     outOfRange=-1L,
+     outOfRange=0L,
+     outOfRange=1e9L
+   )
+ 
+   data <- readPgf(pgf)
+   str(head(data))
+   stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+   stopifnot(length(data$probesetName) == Jall)
+ 
+   # Read different subsets of units
+   for (ii in seq_along(idxsList)) {
+     name <- names(idxsList)[ii]
+     message(sprintf("Testing readPgf() with '%s' indices...", name))
+     idxs <- idxsList[[ii]]
+     str(list(idxs=idxs))
+     if (grepl("outOfRange", name)) {
+       res <- tryCatch(readPgf(pgf, indices=idxs), error=function(ex) ex)
+       str(res)
+       stopifnot(inherits(res, "error"))
+     } else {
+       data <- readPgf(pgf, indices=idxs)
+       str(head(data))
+       stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+       J <- if (is.null(idxs)) Jall else length(idxs)
+       stopifnot(length(data$probesetName) == J)
+     }
+     message(sprintf("Testing readPgf() with '%s' indices...done", name))
+   } # for (ii ...)
+ 
+ 
+   # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+   # Validate correctness of subsets
+   # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+   subsetPgf <- function(data, indices=NULL, ...) {
+     if (is.null(indices)) return(data)
+ 
+     # Atoms
+     offsets <- data$probesetStartAtom
+     natoms <- diff(c(offsets, length(data0$atomStartProbe)+1L))
+     offsets <- offsets[indices]
+     natoms <- natoms[indices]
+     # Identify atoms to keep
+     keep <- logical(length(data$atomStartProbe))
+     for (kk in seq_along(offsets)) {
+       keep[seq(from=offsets[kk], by=1L, length=natoms[kk])] <- TRUE;
+     }
+ 
+     for (ff in c("probeSequence", "probeId", "probeGcCount", "atomExonPosition", "atomId", "probeInterrogationPosition", "probeLength", "probeType")) {
+       data[[ff]] <- data[[ff]][keep]
+     }
+ 
+     data$atomStartProbe <- seq_len(sum(natoms))
+     data$probesetStartAtom <- c(1L, cumsum(natoms))[length(indices)]
+ 
+     # Probesets
+     for (ff in c("probesetName", "probesetId", "probesetType")) {
+       data[[ff]] <- data[[ff]][indices]
+     }
+ 
+     data
+   } # subsetPgf()
+ 
+   data0 <- readPgf(pgf)
+   Jall <- length(data0$probesetId)
+ 
+   for (kk in 1:10) {
+     n <- sample(Jall, size=1L)
+     idxs <- sort(sample(1:Jall, size=n, replace=FALSE))
+     data <- readPgf(pgf, indices=idxs)
+     dataS <- subsetPgf(data0, indices=idxs)
+     for (ff in c("probesetStartAtom", "atomExonPosition"))
+       data[[ff]] <- dataS[[ff]] <- NULL
+     stopifnot(all.equal(data, dataS))
+   }
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
 $ probeSequence    : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:10] "" "" "" "" ...
 $ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
 $ probeId          : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
 $ probesetType     : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...
List of 1
 $ idxs: NULL
List of 6
 $ probeSequence    : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:10] "" "" "" "" ...
 $ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
 $ probeId          : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
 $ probesetType     : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...done
Testing readPgf() with 'readOne' indices...
List of 1
 $ idxs: int 5
List of 6
 $ probeSequence    : chr [1:4] "AGATGTGTATAGAGGGTTTAACTTA" "TGTGTATAGAGGGTTTAACTTAAAT" "GTGTATAGAGGGTTTAACTTAAATA" "GATGTGTATAGAGGGTTTAACTTAA"
 $ probesetName     : chr ""
 $ probesetStartAtom: int 1
 $ probeId          : int [1:4] 611456 834021 857576 980218
 $ probesetId       : int 7892505
 $ probesetType     : chr "normgene->intron"
Testing readPgf() with 'readOne' indices...done
Testing readPgf() with 'readSome' indices...
List of 1
 $ idxs: int [1:5] 1 2 3 4 5
List of 6
 $ probeSequence    : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:5] "" "" "" "" ...
 $ probesetStartAtom: int [1:5] 1 5 9 13 17
 $ probeId          : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:5] 7892501 7892502 7892503 7892504 7892505
 $ probesetType     : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readSome' indices...done
Testing readPgf() with 'readDouble' indices...
List of 1
 $ idxs: num [1:5] 1 2 3 4 5
List of 6
 $ probeSequence    : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
 $ probesetName     : chr [1:5] "" "" "" "" ...
 $ probesetStartAtom: int [1:5] 1 5 9 13 17
 $ probeId          : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
 $ probesetId       : int [1:5] 7892501 7892502 7892503 7892504 7892505
 $ probesetType     : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readDouble' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int -1
List of 2
 $ message: chr "Argument 'indices' contains a non-positive element"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int 0
List of 2
 $ message: chr "Argument 'indices' contains a non-positive element"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
 $ idxs: int 1000000000
List of 2
 $ message: chr "Argument 'indices' contains an element out of range [1,10]: 1000000000"
 $ call   : language readPgfEnv(file, readBody = TRUE, indices = indices)
 - attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
> 
> proc.time()
   user  system elapsed 
  0.138   0.039   0.173 

affxparser.Rcheck/tests/testWriteAndReadEmptyCdf.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> systemR <- function(command="", ..., verbose=FALSE) {
+   # Locate the R executable
+   Rbin <- file.path(R.home("bin"), "R")
+   cmd <- sprintf('%s %s', shQuote(Rbin), command)
+   if (verbose) cat("Command: ", cmd, "\n", sep="")
+   system(cmd, ...)
+ } # systemR()
> 
> 
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCdf()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R'  -e ".libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpTFltEB/RLIBS_e3e729c0c27'); affxparser:::.testWriteAndReadEmptyCdf()"
> cat(out, sep="\n")

R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> .libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpTFltEB/RLIBS_e3e729c0c27'); affxparser:::.testWriteAndReadEmptyCdf()
Pathname: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/testscripts/writeAndReadEmptyCdf.R

> library("affxparser")

> hdr <- list(chiptype = "Empty2x3", nrows = 2, ncols = 3, 
+     nunits = 0, nqcunits = 0, refseq = "")

> units <- qcUnits <- list()

> pathname <- file.path(tempdir(), "Empty2x3.cdf")

> str(pathname)
 chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpIUTxrx/Empty2x3.cdf"

> writeCdf(pathname, cdfheader = hdr, cdf = units, cdfqc = qcUnits, 
+     overwrite = TRUE)

> hdr2 <- readCdfHeader(pathname)

> str(hdr2)
List of 12
 $ ncols      : int 3
 $ nrows      : int 2
 $ nunits     : int 0
 $ nqcunits   : int 0
 $ refseq     : chr ""
 $ chiptype   : chr "Empty2x3"
 $ filename   : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpIUTxrx/Empty2x3.cdf"
 $ rows       : int 2
 $ cols       : int 3
 $ probesets  : int 0
 $ qcprobesets: int 0
 $ reference  : chr ""

> units2 <- readCdfUnits(pathname)

> str(units2)
 Named list()
COMPLETE
> 
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+   stop("affxparser:::.testWriteAndReadEmptyCdf() failed.")
+ }
> 
> ############################################################################
> # HISTORY:
> # 2012-05-22
> # o ROBUSTNESS: Now launching R without assuming it is on the search path,
> #   cf. R-devel thread 'Best way to locate R executable from within R?'
> #   on May 22, 2012.
> # 2012-05-18
> # o Added because of the OSX build bug, cf.
> #   https://groups.google.com/d/topic/aroma-affymetrix/lEfDanThLEA/discussion
> # o Created.
> ############################################################################
> 
> proc.time()
   user  system elapsed 
  0.166   0.058   0.243 

affxparser.Rcheck/tests/testWriteAndReadEmptyCel.Rout


R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> systemR <- function(command="", ..., verbose=FALSE) {
+   # Locate the R executable
+   Rbin <- file.path(R.home("bin"), "R")
+   cmd <- sprintf('%s %s', shQuote(Rbin), command)
+   if (verbose) cat("Command: ", cmd, "\n", sep="")
+   system(cmd, ...)
+ } # systemR()
> 
> 
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCel()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R'  -e ".libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpTFltEB/RLIBS_e3e729c0c27'); affxparser:::.testWriteAndReadEmptyCel()"
> cat(out, sep="\n")

R version 4.6.0 Patched (2026-04-24 r89963) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> .libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpTFltEB/RLIBS_e3e729c0c27'); affxparser:::.testWriteAndReadEmptyCel()
Pathname: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/testscripts/writeAndReadEmptyCel.R

> library("affxparser")

> hdr <- list(version = 4, chiptype = "Empty2x3", rows = 2, 
+     cols = 3, algorithm = "Percentile\nAlgorithm", parameters = "Percentile:75;CellMarg ..." ... [TRUNCATED] 

> hdr$header <- sprintf("Cols=%d\nRows=%d\nTotalX=%d\nTotalY=%d\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCornerLR=3565  ..." ... [TRUNCATED] 

> pathname <- file.path(tempdir(), "Empty2x3.cel")

> str(pathname)
 chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmp2Rc3P6/Empty2x3.cel"

> createCel(pathname, header = hdr, overwrite = TRUE)

> hdr2 <- readCelHeader(pathname)

> str(hdr2)
List of 14
 $ filename      : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmp2Rc3P6/Empty2x3.cel"
 $ version       : int 4
 $ cols          : int 3
 $ rows          : int 2
 $ total         : int 6
 $ algorithm     : chr "Percentile\nAlgorithm"
 $ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
 $ chiptype      : chr "Empty2x3"
 $ header        : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
 $ datheader     : chr "[13..25244]  050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1  YIN=1  VE=30        2.0 09/26/12 10:01:02 50102"| __truncated__
 $ librarypackage: chr ""
 $ cellmargin    : int 2
 $ noutliers     : int 0
 $ nmasked       : int 0

> data2 <- readCel(pathname)

> str(data2)
List of 4
 $ header     :List of 14
  ..$ filename      : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmp2Rc3P6/Empty2x3.cel"
  ..$ version       : int 4
  ..$ cols          : int 3
  ..$ rows          : int 2
  ..$ total         : int 6
  ..$ algorithm     : chr "Percentile\nAlgorithm"
  ..$ parameters    : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
  ..$ chiptype      : chr "Empty2x3"
  ..$ header        : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
  ..$ datheader     : chr "[13..25244]  050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1  YIN=1  VE=30        2.0 09/26/12 10:01:02 50102"| __truncated__
  ..$ librarypackage: chr ""
  ..$ cellmargin    : int 2
  ..$ noutliers     : int 0
  ..$ nmasked       : int 0
 $ intensities: num [1:6] 0 0 0 0 0 0
 $ outliers   : NULL
 $ masked     : NULL
COMPLETE
> 
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+   stop("affxparser:::.testWriteAndReadEmptyCel() failed.")
+ }
> 
> ############################################################################
> # HISTORY:
> # 2012-09-26
> # o Created from tests/testWriteAndReadEmptyCdf.R.
> ############################################################################
> 
> proc.time()
   user  system elapsed 
  0.178   0.066   0.270 

Example timings

affxparser.Rcheck/affxparser-Ex.timings

nameusersystemelapsed
applyCdfGroups0.0210.0190.043
convertCdf0.2430.0080.254
convertCel0.0340.0050.040
createCel0.0670.0060.074
findCdf0.0160.0040.020
invertMap0.2090.0030.212
readCdfDataFrame0.2620.0090.272
readCdfHeader0.0020.0000.003
readCdfNbrOfCellsPerUnitGroup0.1250.0660.204
readCdfUnitNames000
readCdfUnits0.5360.0170.559
readCdfUnitsWriteMap0.2010.0090.210
readCel0.0030.0000.003
readCelHeader000
readCelIntensities000
readCelRectangle0.0920.0060.100
readCelUnits0.0050.0010.006
readChp0.0050.0020.007
updateCel0.2800.0350.325
updateCelUnits0.5930.0800.693