##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings FLAMES_2.6.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck’
* using R version 4.6.0 RC (2026-04-17 r89917)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
* running under: Ubuntu 24.04.4 LTS
* using session charset: UTF-8
* current time: 2026-04-30 04:07:49 UTC
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.6.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
* checking C++ specification ... INFO
  specified C++17
* checking installed package size ... INFO
  installed size is  8.8Mb
  sub-directories of 1Mb or more:
    bin    4.6Mb
    data   1.9Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: ‘scuttle’
  All declared Imports should be used.
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  ‘gene_quantification’ ‘isoform_identification’ ‘minimap2_align’
  ‘transcript_quantification’
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
barcode_group: no visible global function definition for ‘new’
barcode_segment: no visible global function definition for ‘new’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_diversity: no visible global function definition for ‘as’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘CB’
plot_demultiplex_raw: no visible binding for global variable ‘UB’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_isoforms: no visible binding for global variable ‘xmin’
plot_isoforms: no visible binding for global variable ‘xmax’
plot_isoforms: no visible binding for global variable ‘ymin’
plot_isoforms: no visible binding for global variable ‘ymax’
plot_isoforms: no visible binding for global variable ‘x’
plot_isoforms: no visible binding for global variable ‘xend’
plot_isoforms: no visible binding for global variable ‘y’
plot_isoforms: no visible binding for global variable ‘yend’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_files’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  CB Count FSM_match FlankEditDist Freq Reads Sample Type UB UMI_count
  adj.p.value allele allele_count as bam_index barcode barcode_rank
  barcodes_file barcodes_files capture.output cell_total_reads
  chisq.test count counts_no_ins cumpct demultiplexed reads
  demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x xend xmax xmin y yend ymax ymin
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
blaze                         6.495 17.297  16.403
plot_isoform_reduced_dim     21.119  1.506  22.645
find_variants                20.659  1.699  21.518
bulk_long_pipeline            6.949 12.425   2.619
sc_long_multisample_pipeline  8.604  5.644   8.471
sc_plot_genotype             11.325  2.416  11.867
MultiSampleSCPipeline        10.400  0.644  11.306
sc_DTU_analysis               6.969  2.518   7.405
create_sce_from_dir           3.611  1.915   3.605
create_se_from_dir            5.226  0.185   5.398
plot_durations                5.134  0.195   5.316
resume_FLAMES                 4.905  0.132   5.025
run_FLAMES                    4.870  0.151   5.011
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.23-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.6.0’
** using non-staged installation via StagedInstall field
** libs
specified C++17
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |                 if (blocks.size() >= (int)this->Min_sup_cnt) {
      |                     ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |         if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |              ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |                 (right_counts.size() < (int)this->Min_sup_cnt)) {
      |                  ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |                                 for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                                                 ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |                         for (int i = 0; i < new_exons.size(); ++i) {
      |                                         ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                            ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |                         for (int i = 0; i < exons.size(); i+=2) {
      |                                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:142:56: warning: comparison of integer expressions of different signedness: ‘__gnu_cxx::__alloc_traits<std::allocator<unsigned int>, unsigned int>::value_type’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare]
  142 |       if (j == (len2 - 1) && dist_holder[i * len2 + j] < best) {
main-functions/flexiplex.cpp: In function ‘void refine_matched_segments(const std::string&, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_set<std::__cxx11::basic_string<char> > >*, const std::vector<int>&, Barcode&, std::vector<int>&, std::vector<int>&)’:
main-functions/flexiplex.cpp:348:70: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
  348 |         } else if (editDistance < best_edit_distance && editDistance <= s.max_edit_distance) {
      |                                                         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:30: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
  356 |       if (best_edit_distance <= s.max_edit_distance && current_segment_unambiguous) {
      |           ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, BGZF*, bool, bool, bool, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, BarcodeGroup>&)’:
main-functions/flexiplex.cpp:790:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
  790 |   for (int b = 0; b < vec_size; b++) {
      |                   ~~^~~~~~~~~~
main-functions/flexiplex.cpp:803:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
  803 |     for (int k = 0; k < vec_size; k++) {
      |                     ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’:
main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  268 |   for (int i = 0; i < BASES.size(); i++) {
      |                   ~~^~~~~~~~~~~~~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’:
main-functions/pileup_readid.cpp:342:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
   86 |   unsigned int end;
      |                ^~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’:
main-functions/pileup_readid.cpp:344:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -std=gnu2x -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.23-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.23-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-g -O2  -Wall -Werror=format-security -Wno-unused-result" minimap2)
make[1]: Entering directory '/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/submodule/minimap2'
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  main.c -o main.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kthread.c -o kthread.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kalloc.c -o kalloc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  misc.c -o misc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  bseq.c -o bseq.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sketch.c -o sketch.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sdust.c -o sdust.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  options.c -o options.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  index.c -o index.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  lchain.c -o lchain.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  align.c -o align.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  hit.c -o hit.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  seed.c -o seed.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  jump.c -o jump.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  map.c -o map.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  format.c -o format.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  pe.c -o pe.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  esterr.c -o esterr.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  splitidx.c -o splitidx.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -DHAVE_KALLOC  ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
ar: `u' modifier ignored since `D' is the default (see `U')
cc -g -O2  -Wall -Werror=format-security -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
make[1]: Leaving directory '/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/submodule/minimap2'
echo "Installing binary to /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
    Updating crates.io index
  Installing oarfish v0.8.0
    Updating crates.io index
     Locking 279 packages to latest compatible versions
      Adding generic-array v0.14.7 (available: v0.14.9)
      Adding indicatif v0.17.11 (available: v0.18.4)
      Adding needletail v0.6.3 (available: v0.7.3)
      Adding noodles-bam v0.78.0 (available: v0.88.0)
      Adding noodles-bgzf v0.38.0 (available: v0.46.0)
      Adding noodles-sam v0.74.0 (available: v0.84.0)
      Adding rand v0.9.4 (available: v0.10.1)
      Adding tabled v0.18.0 (available: v0.20.0)
      Adding typed-builder v0.21.2 (available: v0.23.2)
   Compiling libc v0.2.186
   Compiling proc-macro2 v1.0.106
   Compiling quote v1.0.45
   Compiling unicode-ident v1.0.24
   Compiling find-msvc-tools v0.1.9
   Compiling shlex v1.3.0
   Compiling cfg-if v1.0.4
   Compiling autocfg v1.5.0
   Compiling pkg-config v0.3.33
   Compiling libm v0.2.16
   Compiling memchr v2.8.0
   Compiling zerocopy v0.8.48
   Compiling crossbeam-utils v0.8.21
   Compiling version_check v0.9.5
   Compiling adler2 v2.0.1
   Compiling simd-adler32 v0.3.9
   Compiling crc32fast v1.5.0
   Compiling once_cell v1.21.4
   Compiling serde_core v1.0.228
   Compiling regex-syntax v0.8.10
   Compiling zlib-rs v0.6.3
   Compiling pin-project-lite v0.2.17
   Compiling rawpointer v0.2.1
   Compiling typenum v1.20.0
   Compiling hashbrown v0.17.0
   Compiling equivalent v1.0.2
   Compiling futures-core v0.3.32
   Compiling getrandom v0.3.4
   Compiling either v1.15.0
   Compiling serde v1.0.228
   Compiling paste v1.0.15
   Compiling lexical-util v1.0.7
   Compiling futures-sink v0.3.32
   Compiling slab v0.4.12
   Compiling futures-task v0.3.32
   Compiling vcpkg v0.2.15
   Compiling heck v0.5.0
   Compiling zstd-safe v7.2.4
   Compiling futures-io v0.3.32
   Compiling bytecount v0.6.9
   Compiling bitflags v2.11.1
   Compiling zstd-safe v6.0.6
   Compiling snap v1.1.1
   Compiling zmij v1.0.21
   Compiling rustversion v1.0.22
   Compiling utf8parse v0.2.2
   Compiling getrandom v0.4.2
   Compiling rustix v1.1.4
   Compiling lazy_static v1.5.0
   Compiling rayon-core v1.13.0
   Compiling semver v1.0.28
   Compiling itoa v1.0.18
   Compiling byteorder v1.5.0
   Compiling anyhow v1.0.102
   Compiling bytes v1.11.1
   Compiling unicode-width v0.2.2
   Compiling thiserror v1.0.69
   Compiling static_assertions v1.1.0
   Compiling fallible-streaming-iterator v0.1.9
   Compiling log v0.4.29
   Compiling anstyle v1.0.14
   Compiling linux-raw-sys v0.12.1
   Compiling colorchoice v1.0.5
   Compiling bit-vec v0.8.0
   Compiling portable-atomic v1.13.1
   Compiling anstyle-query v1.1.5
   Compiling smallvec v1.15.1
   Compiling array-init-cursor v0.2.1
   Compiling is_terminal_polyfill v1.70.2
   Compiling serde_json v1.0.149
   Compiling seq-macro v0.3.6
   Compiling fnv v1.0.7
   Compiling thread_local v1.1.9
   Compiling strsim v0.11.1
   Compiling nu-ansi-term v0.50.3
   Compiling fastrand v2.4.1
   Compiling miniz_oxide v0.8.9
   Compiling tracing-core v0.1.36
   Compiling planus v0.3.1
   Compiling cpufeatures v0.2.17
   Compiling clap_lex v1.1.0
   Compiling rustc_version v0.4.1
   Compiling sharded-slab v0.1.7
   Compiling simdutf8 v0.1.5
   Compiling streaming-iterator v0.1.9
   Compiling twox-hash v1.6.3
   Compiling base64 v0.21.7
   Compiling base64 v0.22.1
   Compiling hex v0.4.3
   Compiling hash_hasher v2.0.4
   Compiling ethnum v1.5.3
   Compiling number_prefix v0.4.0
   Compiling foreign_vec v0.1.0
   Compiling generic-array v0.14.7
   Compiling ahash v0.8.12
   Compiling dyn-clone v1.0.20
   Compiling itertools v0.13.0
   Compiling futures-channel v0.3.32
   Compiling anstyle-parse v1.0.0
   Compiling streaming-decompression v0.1.2
   Compiling itertools v0.14.0
   Compiling ryu v1.0.23
   Compiling arrayvec v0.7.6
   Compiling num-traits v0.2.19
   Compiling matrixmultiply v0.3.10
   Compiling num-complex v0.2.4
   Compiling rustc-hash v2.1.2
   Compiling parse-size v1.1.0
   Compiling path-tools v0.1.0
   Compiling atomic_float v1.1.0
   Compiling arrow2 v0.18.0
   Compiling aho-corasick v1.1.4
   Compiling buffer-redux v1.1.0
   Compiling anstream v1.0.0
   Compiling csv-core v0.1.13
   Compiling papergrid v0.14.0
   Compiling lexical-parse-integer v1.0.6
   Compiling lexical-write-integer v1.0.6
   Compiling lz4_flex v0.10.0
   Compiling indexmap v2.14.0
   Compiling tracing-log v0.2.0
   Compiling num-format v0.4.4
   Compiling lexical-parse-float v1.0.6
   Compiling clap_builder v4.6.0
   Compiling crossbeam-channel v0.5.15
   Compiling crossbeam-epoch v0.9.18
   Compiling crossbeam-queue v0.3.12
   Compiling lexical-write-float v1.0.6
   Compiling crossbeam-deque v0.8.6
   Compiling lexical-core v1.0.6
   Compiling crypto-common v0.1.7
   Compiling block-buffer v0.10.4
   Compiling syn v2.0.117
   Compiling digest v0.10.7
   Compiling proc-macro-error-attr2 v2.0.0
   Compiling crossbeam v0.8.4
   Compiling getrandom v0.2.17
   Compiling console v0.15.11
   Compiling num_cpus v1.17.0
   Compiling rand_core v0.9.5
   Compiling rand_core v0.6.4
   Compiling rayon v1.12.0
   Compiling jobserver v0.1.34
   Compiling indicatif v0.17.11
   Compiling cc v1.2.61
   Compiling regex-automata v0.4.14
   Compiling tempfile v3.27.0
   Compiling num-integer v0.1.46
   Compiling num-complex v0.4.6
   Compiling approx v0.5.1
   Compiling noisy_float v0.2.1
   Compiling approx v0.3.2
   Compiling chrono v0.4.44
   Compiling num-bigint v0.4.6
   Compiling num-iter v0.1.45
   Compiling csv v1.4.0
   Compiling alga v0.9.3
   Compiling flate2 v1.1.9
   Compiling ndarray v0.16.1
   Compiling ndarray v0.17.2
   Compiling ndarray v0.15.6
   Compiling zstd-sys v2.0.16+zstd.1.5.7
   Compiling bzip2-sys v0.1.13+1.0.8
   Compiling liblzma-sys v0.3.13
   Compiling libz-sys v1.1.28
   Compiling sha2-asm v0.6.4
   Compiling minimap2-sys v0.1.30+minimap2.2.30
   Compiling lz4-sys v1.11.1+lz4-1.10.0
   Compiling noodles-bgzf v0.38.0
   Compiling sha2 v0.10.9
   Compiling num-rational v0.4.2
   Compiling proc-macro-error2 v2.0.1
   Compiling liblzma v0.3.6
   Compiling num v0.4.3
   Compiling bytemuck_derive v1.10.2
   Compiling futures-macro v0.3.32
   Compiling serde_derive v1.0.228
   Compiling tracing-attributes v0.1.31
   Compiling async-trait v0.1.89
   Compiling async-stream-impl v0.3.6
   Compiling thiserror-impl v1.0.69
   Compiling strum_macros v0.26.4
   Compiling typed-builder-macro v0.21.2
   Compiling clap_derive v4.6.1
   Compiling tabled_derive v0.10.0
   Compiling derive-new v0.6.0
   Compiling ppv-lite86 v0.2.21
   Compiling async-stream v0.3.6
   Compiling hashbrown v0.14.5
   Compiling futures-util v0.3.32
   Compiling tabled v0.18.0
   Compiling rand_chacha v0.3.1
   Compiling rand_chacha v0.9.0
   Compiling bytemuck v1.25.0
   Compiling tracing v0.1.44
   Compiling rand v0.8.6
   Compiling rand v0.9.4
   Compiling safe_arch v0.7.4
   Compiling typed-builder v0.21.2
   Compiling clap v4.6.1
   Compiling wide v0.7.33
   Compiling rand_distr v0.4.3
   Compiling bstr v1.12.1
   Compiling matchers v0.2.0
   Compiling regex v1.12.3
   Compiling tracing-subscriber v0.3.23
   Compiling bzip2 v0.4.4
   Compiling noodles-core v0.17.0
   Compiling ndarray-stats v0.6.0
   Compiling noodles-csi v0.46.0
   Compiling simba v0.9.1
   Compiling noodles-sam v0.74.0
   Compiling arrow-format v0.8.1
   Compiling bincode v1.3.3
   Compiling bio-types v1.0.4
   Compiling kders v0.1.1
   Compiling sendable-swapvec v0.4.3
   Compiling futures-executor v0.3.32
   Compiling futures v0.3.32
   Compiling parquet-format-safe v0.2.4
   Compiling sprs v0.11.4
   Compiling lz4 v1.28.1
   Compiling noodles-bam v0.78.0
   Compiling nalgebra v0.33.3
   Compiling zstd v0.12.4
   Compiling zstd v0.13.3
   Compiling parquet2 v0.17.2
   Compiling needletail v0.6.3
   Compiling minimap2 v0.1.31+minimap2.2.30
   Compiling seqcol_rs v0.4.1
   Compiling statrs v0.18.0
   Compiling oarfish v0.8.0
    Finished `release` profile [optimized] target(s) in 49.71s
  Installing /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/cargo_temp/bin/oarfish
   Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
    Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af081be057/config_file_1989360.json
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af081be057/config_file_1989360.json
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af081be057/config_file_1989360.json
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af02c48f04f/config_file_1989360.json
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af06e042de6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af03831a2b9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af03831a2b9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af036cf432b/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af036cf432b/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af036cf432b/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af036cf432b/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af049c9a18d/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
2 transcripts found in the BAM file.
1(50%) transcripts failed the filter.
Failed transcripts account for 100 reads, out of 200(50%) reads in total.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af06fa5815/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:17:12 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Apr 30 00:17:14 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:17:39 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af06fa5815/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Thu Apr 30 00:17:40 2026 ----------
2026-04-30T04:17:40.600908Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:17:40.601378Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af06fa5815/sample1_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:17:40.601402Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:17:40.601413Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:17:40.601480Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:17:40.601494Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:17:40.605695Z  INFO oarfish::alignment_parser: the alignment file contained 1 unmapped read records.
2026-04-30T04:17:40.605886Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 686   │
│ aligned fraction too low        │ 16    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 4     │
│ reads with valid best alignment │ 283   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:17:40.605943Z  INFO oarfish::bulk: Total number of alignment records : 364
2026-04-30T04:17:40.605963Z  INFO oarfish::bulk: number of aligned reads : 283
2026-04-30T04:17:40.605974Z  INFO oarfish::bulk: number of unique alignments : 235
2026-04-30T04:17:40.606874Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:17:40.613743Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:17:40.614074Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af06fa5815/sample2_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:17:40.614111Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:17:40.614121Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:17:40.614170Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:17:40.614192Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:17:40.617965Z  INFO oarfish::alignment_parser: the alignment file contained 1 unmapped read records.
2026-04-30T04:17:40.618153Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 695   │
│ aligned fraction too low        │ 14    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 7     │
│ reads with valid best alignment │ 285   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:17:40.618206Z  INFO oarfish::bulk: Total number of alignment records : 369
2026-04-30T04:17:40.618216Z  INFO oarfish::bulk: number of aligned reads : 285
2026-04-30T04:17:40.618225Z  INFO oarfish::bulk: number of unique alignments : 235
2026-04-30T04:17:40.619152Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:17:40.625935Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:17:40.626259Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af06fa5815/sample3_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:17:40.626298Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:17:40.626309Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:17:40.626367Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:17:40.626382Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:17:40.630346Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-30T04:17:40.630528Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 696   │
│ aligned fraction too low        │ 14    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 284   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:17:40.630582Z  INFO oarfish::bulk: Total number of alignment records : 362
2026-04-30T04:17:40.630594Z  INFO oarfish::bulk: number of aligned reads : 284
2026-04-30T04:17:40.630603Z  INFO oarfish::bulk: number of unique alignments : 237
2026-04-30T04:17:40.631544Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af02ebf721b/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:17:40 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample1_align2genome.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample2_align2genome.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Apr 30 00:18:06 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:18:29 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af02ebf721b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:18:50 2026 ----------
2026-04-30T04:18:50.239550Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:18:50.240038Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af02ebf721b/sample1_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:18:50.240062Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:18:50.240095Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:18:50.240158Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:18:50.240170Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:18:50.244762Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-30T04:18:50.245014Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 702   │
│ aligned fraction too low        │ 13    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 285   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:18:50.245074Z  INFO oarfish::bulk: Total number of alignment records : 364
2026-04-30T04:18:50.245083Z  INFO oarfish::bulk: number of aligned reads : 285
2026-04-30T04:18:50.245090Z  INFO oarfish::bulk: number of unique alignments : 238
2026-04-30T04:18:50.246009Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:18:50.257536Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:18:50.257965Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af02ebf721b/sample2_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:18:50.257988Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:18:50.257997Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:18:50.258073Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:18:50.258086Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:18:50.261999Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-30T04:18:50.262215Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 687   │
│ aligned fraction too low        │ 16    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 6     │
│ reads with valid best alignment │ 282   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:18:50.262288Z  INFO oarfish::bulk: Total number of alignment records : 355
2026-04-30T04:18:50.262302Z  INFO oarfish::bulk: number of aligned reads : 282
2026-04-30T04:18:50.262309Z  INFO oarfish::bulk: number of unique alignments : 240
2026-04-30T04:18:50.263188Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:18:50.274594Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:18:50.275078Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af02ebf721b/sample3_realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:18:50.275130Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:18:50.275138Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:18:50.275193Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:18:50.275210Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:18:50.279274Z  INFO oarfish::alignment_parser: the alignment file contained 2 unmapped read records.
2026-04-30T04:18:50.279483Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 688   │
│ aligned fraction too low        │ 15    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 7     │
│ reads with valid best alignment │ 283   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:18:50.279554Z  INFO oarfish::bulk: Total number of alignment records : 354
2026-04-30T04:18:50.279562Z  INFO oarfish::bulk: number of aligned reads : 283
2026-04-30T04:18:50.279570Z  INFO oarfish::bulk: number of unique alignments : 240
2026-04-30T04:18:50.280756Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af020b31ae3/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:18:50 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Apr 30 00:18:52 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:19:12 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af020b31ae3/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:19:13 2026 ----------
00:19:13 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af032f400ff/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:19:15 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample1_align2genome.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample2_align2genome.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Apr 30 00:19:36 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 5 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:19:57 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af032f400ff/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:20:17 2026 ----------
00:20:17 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/RtmpnsqI5q/file1e5af020b31ae3/sample1_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af020b31ae3/sample2_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af020b31ae3/sample3_realign2transcript.bam'] /tmp/RtmpnsqI5q/file1e5af020b31ae3/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 866, 'not_enough_coverage': 30, 'unmapped': 4})
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af0701621bd/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:20:18 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Apr 30 00:20:20 2026 -------------
Inputs:  ['/tmp/RtmpnsqI5q/file1e5af032f400ff/sample1_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af032f400ff/sample2_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af032f400ff/sample3_realign2transcript.bam'] /tmp/RtmpnsqI5q/file1e5af032f400ff/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 863, 'not_enough_coverage': 32, 'unmapped': 5})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:20:20 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af0701621bd/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Thu Apr 30 00:20:23 2026 ----------
2026-04-30T04:20:23.774046Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:20:23.774417Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0701621bd/sample1_realign2transcript.bam, contains 17 reference sequences.
2026-04-30T04:20:23.774439Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:20:23.774472Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:20:23.774562Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:20:23.774577Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-30T04:20:23.784955Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:20:23.785209Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3436  │
│ aligned fraction too low        │ 7     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 293   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:20:23.785269Z  INFO oarfish::bulk: Total number of alignment records : 513
2026-04-30T04:20:23.785282Z  INFO oarfish::bulk: number of aligned reads : 293
2026-04-30T04:20:23.785289Z  INFO oarfish::bulk: number of unique alignments : 198
2026-04-30T04:20:23.786296Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:20:23.794229Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:20:23.794610Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0701621bd/sample2_realign2transcript.bam, contains 17 reference sequences.
2026-04-30T04:20:23.794631Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:20:23.794639Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:20:23.794755Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:20:23.794772Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-30T04:20:23.805254Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:20:23.805481Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3402  │
│ aligned fraction too low        │ 8     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 292   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:20:23.805552Z  INFO oarfish::bulk: Total number of alignment records : 525
2026-04-30T04:20:23.805560Z  INFO oarfish::bulk: number of aligned reads : 292
2026-04-30T04:20:23.805572Z  INFO oarfish::bulk: number of unique alignments : 190
2026-04-30T04:20:23.806486Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:20:23.814046Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:20:23.814391Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0701621bd/sample3_realign2transcript.bam, contains 17 reference sequences.
2026-04-30T04:20:23.814436Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:20:23.814444Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:20:23.814529Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:20:23.814551Z  INFO oarfish: parsed reference information for 17 transcripts.
2026-04-30T04:20:23.824473Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:20:23.824746Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3342  │
│ aligned fraction too low        │ 10    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 290   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:20:23.824826Z  INFO oarfish::bulk: Total number of alignment records : 517
2026-04-30T04:20:23.824835Z  INFO oarfish::bulk: number of aligned reads : 290
2026-04-30T04:20:23.824842Z  INFO oarfish::bulk: number of unique alignments : 192
2026-04-30T04:20:23.825752Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af043bb6fff/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:20:24 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample1_align2genome.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample2_align2genome.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Apr 30 00:20:45 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:20:46 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af043bb6fff/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:21:07 2026 ----------
2026-04-30T04:21:07.660616Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:21:07.661170Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af043bb6fff/sample1_realign2transcript.bam, contains 15 reference sequences.
2026-04-30T04:21:07.661194Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:21:07.661203Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:21:07.661318Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:21:07.661335Z  INFO oarfish: parsed reference information for 15 transcripts.
2026-04-30T04:21:07.671089Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:21:07.671335Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3045  │
│ aligned fraction too low        │ 7     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 293   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:21:07.671418Z  INFO oarfish::bulk: Total number of alignment records : 495
2026-04-30T04:21:07.671426Z  INFO oarfish::bulk: number of aligned reads : 293
2026-04-30T04:21:07.671439Z  INFO oarfish::bulk: number of unique alignments : 208
2026-04-30T04:21:07.672418Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:21:07.683706Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:21:07.684076Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af043bb6fff/sample2_realign2transcript.bam, contains 15 reference sequences.
2026-04-30T04:21:07.684135Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:21:07.684144Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:21:07.684238Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:21:07.684262Z  INFO oarfish: parsed reference information for 15 transcripts.
2026-04-30T04:21:07.693480Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:21:07.693723Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 2896  │
│ aligned fraction too low        │ 10    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 290   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:21:07.693802Z  INFO oarfish::bulk: Total number of alignment records : 511
2026-04-30T04:21:07.693811Z  INFO oarfish::bulk: number of aligned reads : 290
2026-04-30T04:21:07.693817Z  INFO oarfish::bulk: number of unique alignments : 198
2026-04-30T04:21:07.694773Z  INFO oarfish: oarfish completed successfully.
2026-04-30T04:21:07.705848Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:21:07.706202Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af043bb6fff/sample3_realign2transcript.bam, contains 15 reference sequences.
2026-04-30T04:21:07.706223Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:21:07.706262Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:21:07.706346Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:21:07.706361Z  INFO oarfish: parsed reference information for 15 transcripts.
2026-04-30T04:21:07.716039Z  INFO oarfish::alignment_parser: the alignment file contained 0 unmapped read records.
2026-04-30T04:21:07.716281Z  INFO oarfish::bulk: 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 2880  │
│ aligned fraction too low        │ 9     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 291   │
╰─────────────────────────────────┴───────╯

2026-04-30T04:21:07.716370Z  INFO oarfish::bulk: Total number of alignment records : 496
2026-04-30T04:21:07.716378Z  INFO oarfish::bulk: number of aligned reads : 291
2026-04-30T04:21:07.716385Z  INFO oarfish::bulk: number of unique alignments : 206
2026-04-30T04:21:07.717305Z  INFO oarfish: oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af06c6044d2/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:21:07 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Apr 30 00:21:09 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:21:10 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpnsqI5q/file1e5af06c6044d2/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:21:11 2026 ----------
00:21:11 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af02d77b19b/config_file_1989360.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Apr 30 00:21:12 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample1_align2genome.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample2_align2genome.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Apr 30 00:21:34 2026 -------------
Inputs:  ['/tmp/RtmpnsqI5q/file1e5af06c6044d2/sample1_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af06c6044d2/sample2_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af06c6044d2/sample3_realign2transcript.bam'] /tmp/RtmpnsqI5q/file1e5af06c6044d2/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:21:34 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:21:55 2026 ----------
00:21:55 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af090a4246/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:21:56 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af090a4246/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:21:56 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af090a4246/matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af090a4246/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:21:56 2026 ----------------
00:21:56 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af090a4246/align2genome.bam'
Inputs:  ['/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample1_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample2_realign2transcript.bam', '/tmp/RtmpnsqI5q/file1e5af02d77b19b/sample3_realign2transcript.bam'] /tmp/RtmpnsqI5q/file1e5af02d77b19b/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.57gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.56gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 374785.90Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:21:58 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:22:08 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af090a4246/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af090a4246/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af090a4246/matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af090a4246/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Thu Apr 30 00:22:08 2026 ----------
2026-04-30T04:22:08.371698Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:22:08.372194Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af090a4246/realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:22:08.372257Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:22:08.372266Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:22:08.372325Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:22:08.372353Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:22:08.377242Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af01ff009f4/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:22:08 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01ff009f4/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:22:09 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01ff009f4/matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ff009f4/align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:22:28 2026 ----------------
00:22:28 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af01ff009f4/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.51gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.50gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 383686.19Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:22:29 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:22:39 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01ff009f4/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01ff009f4/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01ff009f4/matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ff009f4/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:22:57 2026 ----------
2026-04-30T04:22:57.954227Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:22:57.954760Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01ff009f4/realign2transcript.bam, contains 5 reference sequences.
2026-04-30T04:22:57.954827Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:22:57.954838Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:22:57.954909Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:22:57.954932Z  INFO oarfish: parsed reference information for 5 transcripts.
2026-04-30T04:22:57.960415Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af03c68a55f/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:22:58 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af03c68a55f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:22:58 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af03c68a55f/matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af03c68a55f/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:22:58 2026 ----------------
00:22:58 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af03c68a55f/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.45gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.44gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 407530.51Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:22:59 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:23:12 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af03c68a55f/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af03c68a55f/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af03c68a55f/matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af03c68a55f/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:23:12 2026 ----------
00:23:12 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af093e2a8f/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:23:13 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af093e2a8f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:23:13 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af093e2a8f/matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af093e2a8f/align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:23:33 2026 ----------------
00:23:33 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af093e2a8f/align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.00gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  1.99gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 381605.65Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:23:34 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:23:44 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af093e2a8f/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af093e2a8f/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af093e2a8f/matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af093e2a8f/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:24:04 2026 ----------
00:24:04 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af0681e6889/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:24:05 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0681e6889/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:24:05 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af0681e6889/matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0681e6889/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:24:05 2026 ----------------
00:24:05 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af0681e6889/align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.70gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 348792.87Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:24:06 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:24:06 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0681e6889/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0681e6889/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af0681e6889/matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0681e6889/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Thu Apr 30 00:24:07 2026 ----------
2026-04-30T04:24:07.183788Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:24:07.184317Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0681e6889/realign2transcript.bam, contains 10 reference sequences.
2026-04-30T04:24:07.184341Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:24:07.184385Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:24:07.184457Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:24:07.184471Z  INFO oarfish: parsed reference information for 10 transcripts.
2026-04-30T04:24:07.192328Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af01f4f3f37/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:24:07 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01f4f3f37/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:24:08 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01f4f3f37/matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01f4f3f37/align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:24:27 2026 ----------------
00:24:27 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af01f4f3f37/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.47gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 334655.48Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:24:28 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:24:28 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01f4f3f37/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01f4f3f37/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01f4f3f37/matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01f4f3f37/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:24:46 2026 ----------
2026-04-30T04:24:46.642455Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:24:46.642922Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01f4f3f37/realign2transcript.bam, contains 10 reference sequences.
2026-04-30T04:24:46.643000Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:24:46.643009Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:24:46.643085Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:24:46.643110Z  INFO oarfish: parsed reference information for 10 transcripts.
2026-04-30T04:24:46.652883Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af0259f45d2/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:24:47 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0259f45d2/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:24:47 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af0259f45d2/matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0259f45d2/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:24:48 2026 ----------------
00:24:48 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af0259f45d2/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.11gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.11gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 316131.33Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:24:48 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:24:49 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0259f45d2/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0259f45d2/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af0259f45d2/matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0259f45d2/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:24:49 2026 ----------
00:24:49 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af02fe3097f/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:24:50 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af02fe3097f/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:24:51 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af02fe3097f/matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af02fe3097f/align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:25:09 2026 ----------------
00:25:09 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af02fe3097f/align2genome.bam'
	Counter({'counted_reads': 358})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.40gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  2.39gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 349665.20Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:25:10 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:25:10 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af02fe3097f/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af02fe3097f/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af02fe3097f/matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af02fe3097f/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:25:28 2026 ----------
00:25:28 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af0448272cc/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:25:30 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0448272cc/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 927
Number of chimera reads: 3
All done!
Reads	Barcodes
26	1
23	3
22	1
21	3
20	1
19	1
18	1
16	2
15	1
14	2
13	3
12	5
11	2
10	6
9	9
8	3
7	6
6	11
5	8
4	8
3	39
2	19
1	2
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0448272cc/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	5
6	2
5	7
4	5
3	19
2	27
1	53
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0448272cc/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
7	5
6	4
5	1
4	15
3	12
2	23
1	65
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0448272cc/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:25:31 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:25:34 2026 ----------------
00:25:34 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_align2genome.bam'
	Counter({'counted_reads': 358})
parsing /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.12gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 177166.22Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.42gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 494308.21Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.32gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 527665.06Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 419497.52Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:25:36 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 7 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:26:00 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq, /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Thu Apr 30 00:26:02 2026 ----------
2026-04-30T04:26:02.132041Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:26:02.132487Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0448272cc/sampleA_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:26:02.132508Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:26:02.132559Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:26:02.132613Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:26:02.132625Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:26:02.142202Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:26:02.432246Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:26:02.432751Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0448272cc/sample1_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:26:02.432775Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:26:02.432784Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:26:02.432899Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:26:02.432911Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:26:02.436413Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:26:02.755991Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:26:02.756480Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0448272cc/sample2_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:26:02.756501Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:26:02.756508Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:26:02.756592Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:26:02.756604Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:26:02.760248Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:26:03.053640Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:26:03.054178Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0448272cc/sample3_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:26:03.054202Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:26:03.054210Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:26:03.054270Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:26:03.054312Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:26:03.058777Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af0758fc0b/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:26:03 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0758fc0b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 930
Number of chimera reads: 3
All done!
Reads	Barcodes
28	1
25	1
23	3
22	1
21	1
19	2
18	1
17	1
16	2
15	2
14	2
13	4
12	2
11	5
10	4
9	7
8	7
7	2
6	11
5	12
4	7
3	37
2	20
1	2
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0758fc0b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads	Barcodes
10	1
9	1
8	3
7	2
6	4
5	7
4	6
3	15
2	21
1	60
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0758fc0b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	3
6	1
5	6
4	9
3	19
2	29
1	56
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af0758fc0b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:26:04 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:26:26 2026 ----------------
00:26:26 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_align2genome.bam'
parsing /tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 12.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 162340.88Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.52gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 432473.81Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.02gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 487755.14Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.33gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 368723.54Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:26:27 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:26:54 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq, /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:27:15 2026 ----------
2026-04-30T04:27:15.496529Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:27:15.496981Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0758fc0b/sampleA_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:27:15.497007Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:27:15.497058Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:27:15.497131Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:27:15.497144Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:27:15.506251Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:27:15.843025Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:27:15.843536Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample1_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:27:15.843560Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:27:15.843615Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:27:15.843697Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:27:15.843710Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:27:15.847212Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:27:16.185609Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:27:16.186098Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample2_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:27:16.186124Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:27:16.186132Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:27:16.186225Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:27:16.186238Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:27:16.189735Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:27:16.516360Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:27:16.516812Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af0758fc0b/sample3_realign2transcript.bam, contains 6 reference sequences.
2026-04-30T04:27:16.516837Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:27:16.516846Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:27:16.516945Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:27:16.516957Z  INFO oarfish: parsed reference information for 6 transcripts.
2026-04-30T04:27:16.521171Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af04e38cf5/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:27:17 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04e38cf5/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads	Barcodes
27	1
26	1
24	1
22	2
21	1
20	3
19	1
18	1
17	2
16	2
15	2
14	1
12	1
11	7
10	5
9	5
8	9
7	5
6	13
5	11
4	5
3	33
2	22
1	3
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04e38cf5/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	3
7	2
6	5
5	3
4	9
3	13
2	31
1	55
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04e38cf5/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
9	1
8	3
7	1
6	5
5	5
4	6
3	18
2	30
1	50
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04e38cf5/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:27:18 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:27:22 2026 ----------------
00:27:22 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_align2genome.bam'
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.71gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 150471.54Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.38gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 478364.96Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.02gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 472012.60Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.18gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 371479.79Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:27:23 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:27:47 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq, /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:27:49 2026 ----------
00:27:49 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04e38cf5/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample1_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample2_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04e38cf5/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:27:51 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af07b0fbf01/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 924
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
25	1
22	1
21	3
20	2
19	2
18	1
17	4
16	1
15	1
14	1
13	1
12	1
11	7
10	5
9	3
8	11
7	3
6	5
5	19
4	7
3	35
2	19
1	3
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af07b0fbf01/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	3
6	5
5	8
4	7
3	11
2	23
1	66
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af07b0fbf01/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 277
Number of chimera reads: 0
All done!
Reads	Barcodes
8	1
7	3
6	8
5	5
4	4
3	19
2	22
1	60
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af07b0fbf01/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:27:52 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:28:19 2026 ----------------
00:28:19 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
	Counter({'counted_reads': 262, 'not_enough_coverage': 8, 'unmapped': 2})
	Counter({'counted_reads': 264, 'not_enough_coverage': 8, 'unmapped': 1})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.15gene_group/s]
/home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/python/count_gene.py:704: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 176942.00Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.00gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 482236.94Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.98gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 539446.45Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.66gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 388519.77Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:28:21 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Thu Apr 30 00:28:45 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:29:06 2026 ----------
00:29:06 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample1_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample2_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af07b0fbf01/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af053066f07/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:29:08 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af053066f07/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads	Barcodes
28	1
26	1
21	2
20	3
19	4
17	2
14	4
13	2
12	5
11	7
10	1
9	6
8	4
7	7
6	12
5	15
4	4
3	35
2	19
1	3
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af053066f07/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	4
6	3
5	5
4	8
3	12
2	36
1	54
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af053066f07/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 0
All done!
Reads	Barcodes
9	2
7	1
6	4
5	8
4	14
3	9
2	27
1	59
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af053066f07/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:29:09 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:29:13 2026 ----------------
00:29:13 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af053066f07/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af053066f07/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af053066f07/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
	Counter({'counted_reads': 265, 'not_enough_coverage': 8, 'unmapped': 2})
	Counter({'counted_reads': 261, 'not_enough_coverage': 9, 'unmapped': 1})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.94gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 173163.79Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.41gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 500633.09Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 519611.50Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 22.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 416746.55Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:29:14 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:29:14 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af053066f07/fastq, /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Thu Apr 30 00:29:22 2026 ----------
2026-04-30T04:29:22.565067Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:29:22.565579Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af053066f07/sampleA_realign2transcript.bam, contains 27 reference sequences.
2026-04-30T04:29:22.565606Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:29:22.565615Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:29:22.565989Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:29:22.566014Z  INFO oarfish: parsed reference information for 27 transcripts.
2026-04-30T04:29:22.605181Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:29:23.280291Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:29:23.280873Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af053066f07/sample1_realign2transcript.bam, contains 27 reference sequences.
2026-04-30T04:29:23.280900Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:29:23.280909Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:29:23.281040Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:29:23.281059Z  INFO oarfish: parsed reference information for 27 transcripts.
2026-04-30T04:29:23.294280Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:29:23.863939Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:29:23.864338Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af053066f07/sample2_realign2transcript.bam, contains 27 reference sequences.
2026-04-30T04:29:23.864364Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:29:23.864374Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:29:23.864493Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:29:23.864515Z  INFO oarfish: parsed reference information for 27 transcripts.
2026-04-30T04:29:23.878641Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:29:24.446114Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:29:24.446474Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af053066f07/sample3_realign2transcript.bam, contains 27 reference sequences.
2026-04-30T04:29:24.446500Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:29:24.446509Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:29:24.446634Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:29:24.446654Z  INFO oarfish: parsed reference information for 27 transcripts.
2026-04-30T04:29:24.463111Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:29:25 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 932
Number of chimera reads: 3
All done!
Reads	Barcodes
26	1
25	1
24	1
22	2
21	1
20	4
19	1
18	1
15	3
14	1
13	1
12	3
11	9
10	5
9	5
8	6
7	3
6	15
5	10
4	6
3	37
2	20
1	1
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	4
6	5
5	2
4	9
3	18
2	27
1	56
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads	Barcodes
8	3
7	4
6	4
5	3
4	9
3	17
2	26
1	58
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:29:26 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:29:49 2026 ----------------
00:29:49 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_align2genome.bam'
parsing /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.30gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 139560.78Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.96gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 474082.65Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.48gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 423051.72Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.63gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 372800.51Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:29:50 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:29:51 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:30:17 2026 ----------
2026-04-30T04:30:17.798939Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:30:17.799385Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sampleA_realign2transcript.bam, contains 28 reference sequences.
2026-04-30T04:30:17.799410Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:30:17.799420Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:30:17.799543Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:30:17.799564Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-30T04:30:17.839521Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:30:18.535833Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:30:18.536403Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample1_realign2transcript.bam, contains 28 reference sequences.
2026-04-30T04:30:18.536431Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:30:18.536440Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:30:18.536572Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:30:18.536593Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-30T04:30:18.550268Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:30:19.214525Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:30:19.215056Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample2_realign2transcript.bam, contains 28 reference sequences.
2026-04-30T04:30:19.215083Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:30:19.215094Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:30:19.215225Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:30:19.215253Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-30T04:30:19.229756Z  INFO oarfish::single_cell: Processed 100 cells.
2026-04-30T04:30:19.933598Z  INFO oarfish: setting user-provided filter parameters.
2026-04-30T04:30:19.934022Z  INFO oarfish::alignment_parser: read header from BAM file /tmp/RtmpnsqI5q/file1e5af01ed6f8ca/sample3_realign2transcript.bam, contains 28 reference sequences.
2026-04-30T04:30:19.934049Z  INFO oarfish::alignment_parser: saw minimap2 as a program in the header; proceeding.
2026-04-30T04:30:19.934058Z  INFO oarfish::util::digest_utils: calculating seqcol digest
2026-04-30T04:30:19.934184Z  INFO oarfish::util::digest_utils: done calculating seqcol digest
2026-04-30T04:30:19.934204Z  INFO oarfish: parsed reference information for 28 transcripts.
2026-04-30T04:30:19.950669Z  INFO oarfish::single_cell: Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af06d1278a9/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:30:20 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af06d1278a9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
23	2
22	1
21	1
20	2
19	2
18	4
16	2
15	1
14	1
13	1
12	5
11	6
10	5
9	4
8	7
7	3
6	15
5	11
4	2
3	35
2	23
1	3
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af06d1278a9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 0
All done!
Reads	Barcodes
7	4
6	3
5	9
4	11
3	13
2	23
1	59
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af06d1278a9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	5
6	2
5	8
4	7
3	14
2	32
1	46
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af06d1278a9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:30:22 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_matched_reads.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Apr 30 00:30:25 2026 ----------------
00:30:25 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_align2genome.bam'
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.16gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 171067.61Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.50gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 523528.88Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 459942.10Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.28gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 412532.85Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:30:26 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:30:27 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq, /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Apr 30 00:30:30 2026 ----------
00:30:30 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af06d1278a9/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample1_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample2_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af06d1278a9/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/config_file_1989360.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Apr 30 00:30:33 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04aeda1c3/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads	Barcodes
29	1
24	1
22	1
21	2
20	3
19	1
18	2
16	4
15	1
14	1
13	5
11	4
10	7
9	5
8	9
7	3
6	13
5	14
4	2
3	32
2	20
1	6
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04aeda1c3/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	3
7	1
6	4
5	5
4	8
3	16
2	33
1	50
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04aeda1c3/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
10	1
9	1
7	1
6	4
5	10
4	7
3	16
2	28
1	51
Loading known barcodes from /tmp/RtmpnsqI5q/file1e5af04aeda1c3/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
CB:Z: tag field: CB
Processing file: /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Apr 30 00:30:35 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_align2genome.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_matched_reads.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Apr 30 00:30:58 2026 ----------------
00:30:58 Thu Apr 30 2026 quantify genes 
Using BAM(s): '/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_align2genome.bam',
'/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_align2genome.bam', and
'/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_align2genome.bam'
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 275})
	Counter({'counted_reads': 275, 'not_enough_coverage': 1})
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.13gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 133003.88Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 22.73gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 468218.80Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.55gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 501183.44Read/s]
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.00gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 364013.05Read/s]
-- Running step: isoform_identification @ Thu Apr 30 00:30:59 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Apr 30 00:31:00 2026 -------------------
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample1.fq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample2.fq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_matched_reads.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_realign2transcript.bam
/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Apr 30 00:31:23 2026 ----------
00:31:23 Thu Apr 30 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample1_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample2_realign2transcript.bamdone
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_realign2transcript.bam...
parsing /tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpnsqI5q/file1e5af04aeda1c3/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Filtering for genes with at least 2 detected isoforms ...
	6 isoform(s) left.

Aggregating counts by cluster labels ...

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Filtering for genes with at least 2 isoforms expressing more than 1 counts ...
	3 gene(s), 6 transcript(s) left.

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

[ FAIL 0 | WARN 182 | SKIP 0 | PASS 98 ]

[ FAIL 0 | WARN 182 | SKIP 0 | PASS 98 ]
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 275})
	Counter({'counted_reads': 272})
	Counter({'counted_reads': 358})
> 
> proc.time()
   user  system elapsed 
840.274  58.551 881.368