##############################################################################
##############################################################################
###
### Running command:
###
###   E:\biocbuild\bbs-3.21-bioc\R\bin\R.exe CMD check --no-multiarch --install=check:rfaRm.install-out.txt --library=E:\biocbuild\bbs-3.21-bioc\R\library --no-vignettes --timings rfaRm_1.19.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory 'E:/biocbuild/bbs-3.21-bioc/meat/rfaRm.Rcheck'
* using R Under development (unstable) (2024-10-26 r87273 ucrt)
* using platform: x86_64-w64-mingw32
* R was compiled by
    gcc.exe (GCC) 13.2.0
    GNU Fortran (GCC) 13.2.0
* running under: Windows Server 2022 x64 (build 20348)
* using session charset: UTF-8
* using option '--no-vignettes'
* checking for file 'rfaRm/DESCRIPTION' ... OK
* checking extension type ... Package
* this is package 'rfaRm' version '1.19.0'
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking whether package 'rfaRm' can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking 'build' directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for 'as'
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... WARNING
Error: package or namespace load failed for 'rfaRm':
 .onLoad failed in loadNamespace() for 'rfaRm', details:
  call: readLines(clanMembershipCon)
  error: cannot open the connection to 'https://ftp.ebi.ac.uk/pub/databases/Rfam/CURRENT/database_files/clan_membership.txt.gz'
Call sequence:
6: stop(msg, call. = FALSE, domain = NA)
5: value[[3L]](cond)
4: tryCatchOne(expr, names, parentenv, handlers[[1L]])
3: tryCatchList(expr, classes, parentenv, handlers)
2: tryCatch({
       attr(package, "LibPath") <- which.lib.loc
       ns <- loadNamespace(package, lib.loc)
       env <- attachNamespace(ns, pos = pos, deps, exclude, include.only)
   }, error = function(e) {
       P <- if (!is.null(cc <- conditionCall(e))) 
           paste(" in", deparse(cc)[1L])
       else ""
       msg <- gettextf("package or namespace load failed for %s%s:\n %s", 
           sQuote(package), P, conditionMessage(e))
       if (logical.return && !quietly) 
           message(paste("Error:", msg), domain = NA)
   
Execution halted
All user-level objects in a package should have documentation entries.
See chapter 'Writing R documentation files' in the 'Writing R
Extensions' manual.
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in 'vignettes' ... OK
* checking examples ... ERROR
Running examples in 'rfaRm-Ex.R' failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument
Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous>
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
                    user system elapsed
rfamSequenceRegions 0.28   0.03    5.83
* checking for unstated dependencies in 'tests' ... OK
* checking tests ...
  Running 'runTests.R'
 ERROR
Running the tests in 'tests/runTests.R' failed.
Last 13 lines of output:
  
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument
  
  Test files with failing tests
  
     test_searchFunctions.R 
       E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 WARNING, 1 NOTE
See
  'E:/biocbuild/bbs-3.21-bioc/meat/rfaRm.Rcheck/00check.log'
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   E:\biocbuild\bbs-3.21-bioc\R\bin\R.exe CMD INSTALL rfaRm
###
##############################################################################
##############################################################################


* installing to library 'E:/biocbuild/bbs-3.21-bioc/R/library'
* installing *source* package 'rfaRm' ...
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (rfaRm)

R Under development (unstable) (2024-10-26 r87273 ucrt) -- "Unsuffered Consequences"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-w64-mingw32/x64

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.57.0
No encoding supplied: defaulting to UTF-8.
  format width height colorspace matte filesize density
1    SVG   700    550       sRGB  TRUE    18144   96x96
  format width height colorspace matte filesize density
1    GIF   600   2084       sRGB FALSE    63951   72x72
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument


RUNIT TEST PROTOCOL -- Wed Nov 20 04:13:53 2024 
*********************************************** 
Number of test functions: 1 
Number of errors: 1 
Number of failures: 0 

 
1 Test Suite : 
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument

Test files with failing tests

   test_searchFunctions.R 
     E:/biocbuild/bbs-3.21-bioc/tmpdir/RtmpGKTThB/RLIBS_3b7460ce3f28/rfaRm/unitTests/test_searchFunctions.R 


Error in BiocGenerics:::testPackage("rfaRm") : 
  unit tests failed for package rfaRm
Execution halted