Back to Multiple platform build/check report for BioC 3.22: simplified long |
|
This page was generated on 2025-10-03 12:03 -0400 (Fri, 03 Oct 2025).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 Patched (2025-08-23 r88802) -- "Great Square Root" | 4845 |
lconway | macOS 12.7.1 Monterey | x86_64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4632 |
kjohnson3 | macOS 13.7.7 Ventura | arm64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4577 |
taishan | Linux (openEuler 24.03 LTS) | aarch64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4576 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 988/2337 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
Nirav V Malani
| nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | ERROR | |||||||||
lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | ERROR | OK | |||||||||
kjohnson3 | macOS 13.7.7 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
taishan | Linux (openEuler 24.03 LTS) / aarch64 | OK | OK | ERROR | ||||||||||
To the developers/maintainers of the hiReadsProcessor package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/hiReadsProcessor.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: hiReadsProcessor |
Version: 1.45.1 |
Command: /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.45.1.tar.gz |
StartedAt: 2025-10-03 00:40:44 -0400 (Fri, 03 Oct 2025) |
EndedAt: 2025-10-03 00:45:44 -0400 (Fri, 03 Oct 2025) |
EllapsedTime: 299.4 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: hiReadsProcessor.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.45.1.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck’ * using R version 4.5.1 Patched (2025-08-23 r88802) * using platform: x86_64-pc-linux-gnu * R was compiled by gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0 GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0 * running under: Ubuntu 24.04.3 LTS * using session charset: UTF-8 * checking for file ‘hiReadsProcessor/DESCRIPTION’ ... OK * this is package ‘hiReadsProcessor’ version ‘1.45.1’ * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .BBSoptions These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘hiReadsProcessor’ can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking whether startup messages can be suppressed ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE chunkize: no visible global function definition for ‘breakInChunks’ chunkize: no visible global function definition for ‘detectCores’ clusterSites : <anonymous>: no visible binding for global variable ‘queryHits’ clusterSites: no visible binding for global variable ‘clusteredValue’ clusterSites: no visible binding for global variable ‘clusteredValue.freq’ crossOverCheck: no visible binding for global variable ‘queryHits’ decodeByBarcode: no visible global function definition for ‘metadata<-’ decodeByBarcode: no visible global function definition for ‘metadata’ extractSeqs : <anonymous>: no visible global function definition for ‘metadata’ extractSeqs : <anonymous> : <anonymous> : <anonymous>: no visible global function definition for ‘IRanges’ extractSeqs : <anonymous> : <anonymous>: no visible global function definition for ‘IRanges’ findBarcodes: no visible global function definition for ‘metadata<-’ findBarcodes: no visible global function definition for ‘metadata’ findIntegrations: no visible global function definition for ‘fasta.info’ findIntegrations : <anonymous>: no visible global function definition for ‘IRanges’ findVector : <anonymous>: no visible global function definition for ‘IRanges’ pairUpAlignments : <anonymous>: no visible binding for global variable ‘queryHits’ pairwiseAlignSeqs: no visible global function definition for ‘IRangesList’ pairwiseAlignSeqs: no visible global function definition for ‘IRanges’ primerIDAlignSeqs: no visible global function definition for ‘IRanges’ primerIDAlignSeqs: no visible global function definition for ‘IRangesList’ pslToRangedObject: no visible global function definition for ‘IRanges’ read.BAMasPSL: no visible global function definition for ‘ScanBamParam’ read.BAMasPSL: no visible global function definition for ‘scanBamFlag’ read.BAMasPSL: no visible global function definition for ‘DataFrame’ read.SeqFolder: no visible global function definition for ‘SimpleList’ read.psl: no visible global function definition for ‘mclapply’ read.psl : <anonymous>: no visible binding for global variable ‘matches’ read.psl : <anonymous>: no visible binding for global variable ‘misMatches’ read.psl : <anonymous>: no visible binding for global variable ‘qBaseInsert’ read.psl : <anonymous>: no visible binding for global variable ‘tBaseInsert’ read.psl: no visible binding for global variable ‘matches’ read.psl: no visible binding for global variable ‘misMatches’ read.psl: no visible binding for global variable ‘qBaseInsert’ read.psl: no visible binding for global variable ‘tBaseInsert’ read.sampleInfo: no visible global function definition for ‘SimpleList’ splitSeqsToFiles: no visible global function definition for ‘fasta.info’ vpairwiseAlignSeqs: no visible global function definition for ‘Rle’ vpairwiseAlignSeqs: no visible global function definition for ‘runLength’ vpairwiseAlignSeqs: no visible global function definition for ‘IRanges’ vpairwiseAlignSeqs: no visible global function definition for ‘runValue’ Undefined global functions or variables: DataFrame IRanges IRangesList Rle ScanBamParam SimpleList breakInChunks clusteredValue clusteredValue.freq detectCores fasta.info matches mclapply metadata metadata<- misMatches qBaseInsert queryHits runLength runValue scanBamFlag tBaseInsert * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... NOTE Found the following Rd file(s) with Rd \link{} targets missing package anchors: annotateSites.Rd: SerialParam, doAnnotation blatSeqs.Rd: BiocParallel, SerialParam clusterSites.Rd: BiocParallel, SerialParam doRCtest.Rd: vcountPattern, BiocParallel, SerialParam findAndRemoveVector.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam findAndTrimSeq.Rd: vmatchPattern, pairwiseAlignment, MulticoreParam, SnowParam findIntegrations.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam findLTRs.Rd: BiocParallel, SerialParam, pairwiseAlignment, MulticoreParam, SnowParam findLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment, MulticoreParam, SnowParam findPrimers.Rd: vmatchPattern, pairwiseAlignment, SerialParam, MulticoreParam, SnowParam findVector.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam getSonicAbund.Rd: sonicLength, BiocParallel, SerialParam isuSites.Rd: BiocParallel, SerialParam otuSites.Rd: BiocParallel, SerialParam pairUpAlignments.Rd: BiocParallel, SerialParam pairwiseAlignSeqs.Rd: pairwiseAlignment, BiocParallel, SerialParam, MulticoreParam, SnowParam primerIDAlignSeqs.Rd: pairwiseAlignment read.blast8.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam read.psl.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam troubleshootLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment, MulticoreParam, SnowParam vpairwiseAlignSeqs.Rd: vmatchPattern, BiocParallel, SerialParam, MulticoreParam, SnowParam write.listedDNAStringSet.Rd: BiocParallel, SerialParam, writeXStringSet, MulticoreParam, SnowParam Please provide package anchors for all Rd \link{} targets not in the package itself and the base packages. * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking data for ASCII and uncompressed saves ... OK * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘hiReadsProcessor-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: findAndTrimSeq > ### Title: Find and trim a short pattern sequence from the subject. > ### Aliases: findAndTrimSeq > > ### ** Examples > > findAndTrimSeq(patternSeq="AGACCCTTTT", + subjectSeqs=DNAStringSet(c("AGACCCTTTTGAGCAGCAT","AGACCCTTGGTCGACTCA", + "AGACCCTTTTGACGAGCTAG")), qualityThreshold=.85, doRC=FALSE, side="left", + offBy=1, alignWay = "slow") Error in (function (cond) : error in evaluating the argument 'x' in selecting a method for function 'start': pattern() has moved from Biostrings to the pwalign package, and is formally defunct in Biostrings >= 2.77.1. Please call pwalign::pattern() to get rid of this error. Calls: findAndTrimSeq ... start -> pattern -> .call_fun_in_pwalign -> .Defunct Execution halted * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking re-building of vignette outputs ... OK * checking PDF version of manual ... OK * DONE Status: 1 ERROR, 3 NOTEs See ‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck/00check.log’ for details.
hiReadsProcessor.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD INSTALL hiReadsProcessor ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.22-bioc/R/site-library’ * installing *source* package ‘hiReadsProcessor’ ... ** this is package ‘hiReadsProcessor’ version ‘1.45.1’ ** using staged installation ** R ** data ** inst ** byte-compile and prepare package for lazy loading Warning message: In fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location Warning in fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 Warning in fun(libname, pkgname) : Package 'hiReadsProcessor' is deprecated and will be removed from Bioconductor version 3.23 ** testing if installed package can be loaded from final location Warning in fun(libname, pkgname) : Package 'hiAnnotator' is deprecated and will be removed from Bioconductor version 3.23 Warning in fun(libname, pkgname) : Package 'hiReadsProcessor' is deprecated and will be removed from Bioconductor version 3.23 ** testing if installed package keeps a record of temporary installation path * DONE (hiReadsProcessor)
hiReadsProcessor.Rcheck/hiReadsProcessor-Ex.timings
name | user | system | elapsed | |
addFeature | 0.171 | 0.018 | 0.190 | |
addListNameToReads | 0.274 | 0.003 | 0.276 | |
annotateSites | 0 | 0 | 0 | |
blatSeqs | 0 | 0 | 0 | |
chunkize | 0.026 | 0.000 | 0.025 | |
clusterSites | 0.283 | 0.000 | 0.283 | |
crossOverCheck | 0.092 | 0.000 | 0.093 | |
dereplicateReads | 0.036 | 0.000 | 0.037 | |
doRCtest | 3.627 | 0.136 | 3.778 | |
extractFeature | 0.141 | 0.078 | 0.122 | |
extractSeqs | 0.343 | 0.025 | 0.368 | |