Multiple platform build/check report for BioC 3.23 - CHECK results for FLAMES on nebbiolo1

Hostname	OS	Arch (*)	R version	Installed pkgs
nebbiolo1	Linux (Ubuntu 24.04.4 LTS)	x86_64	4.6.0 RC (2026-04-17 r89917) -- "Because it was There"	4686
kjohnson3	macOS 13.7.7 Ventura	arm64	4.6.0 alpha (2026-04-08 r89818)	4690
Click on any hostname to see more info about the system (e.g. compilers) () as reported by 'uname -p', except on Windows and Mac OS X*

CHECK results for FLAMES on nebbiolo1

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results

Summary

Package: FLAMES

Version: 2.5.5

Command: /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings FLAMES_2.5.5.tar.gz

StartedAt: 2026-04-21 00:40:13 -0400 (Tue, 21 Apr 2026)

EndedAt: 2026-04-21 01:04:32 -0400 (Tue, 21 Apr 2026)

EllapsedTime: 1459.0 seconds

RetCode: 0

Status: OK

CheckDir: FLAMES.Rcheck

Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings FLAMES_2.5.5.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck’
* using R version 4.6.0 RC (2026-04-17 r89917)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
* running under: Ubuntu 24.04.4 LTS
* using session charset: UTF-8
* current time: 2026-04-21 04:40:14 UTC
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.5.5’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
* checking C++ specification ... INFO
  specified C++17
* checking installed package size ... INFO
  installed size is  8.8Mb
  sub-directories of 1Mb or more:
    bin    4.6Mb
    data   1.9Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: ‘scuttle’
  All declared Imports should be used.
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  ‘gene_quantification’ ‘isoform_identification’ ‘minimap2_align’
  ‘transcript_quantification’
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
barcode_group: no visible global function definition for ‘new’
barcode_segment: no visible global function definition for ‘new’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_diversity: no visible global function definition for ‘as’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘CB’
plot_demultiplex_raw: no visible binding for global variable ‘UB’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_isoforms: no visible binding for global variable ‘xmin’
plot_isoforms: no visible binding for global variable ‘xmax’
plot_isoforms: no visible binding for global variable ‘ymin’
plot_isoforms: no visible binding for global variable ‘ymax’
plot_isoforms: no visible binding for global variable ‘x’
plot_isoforms: no visible binding for global variable ‘xend’
plot_isoforms: no visible binding for global variable ‘y’
plot_isoforms: no visible binding for global variable ‘yend’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_files’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  CB Count FSM_match FlankEditDist Freq Reads Sample Type UB UMI_count
  adj.p.value allele allele_count as bam_index barcode barcode_rank
  barcodes_file barcodes_files capture.output cell_total_reads
  chisq.test count counts_no_ins cumpct demultiplexed reads
  demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x xend xmax xmin y yend ymax ymin
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
find_variants                21.645  1.180  21.757
plot_isoform_reduced_dim     20.877  1.169  22.048
blaze                         4.862 16.787  13.008
bulk_long_pipeline            2.375 13.617   2.600
sc_long_multisample_pipeline  8.370  5.905   8.293
sc_plot_genotype             11.871  0.920  11.610
MultiSampleSCPipeline        10.607  0.760  11.598
sc_DTU_analysis               7.122  1.868   6.981
create_sce_from_dir           5.925  2.918   6.747
sc_genotype                   5.600  0.381   5.821
create_se_from_dir            5.222  0.150   5.357
plot_durations                5.127  0.206   5.317
run_FLAMES                    4.928  0.129   5.042
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/home/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.23-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.5.5’
** using non-staged installation via StagedInstall field
** libs
specified C++17
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  233 |                 if (blocks.size() >= (int)this->Min_sup_cnt) {
      |                     ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  368 |         if ((left_counts.size() < (int)this->Min_sup_cnt) ||
      |              ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
  369 |                 (right_counts.size() < (int)this->Min_sup_cnt)) {
      |                  ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
  662 |                                 for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
      |                                                 ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  713 |                         for (int i = 0; i < new_exons.size(); ++i) {
      |                                         ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
  725 |                                 } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
      |                                            ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
 1140 |                         for (int i = 0; i < exons.size(); i+=2) {
      |                                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  166 |         for (int i = 1; i < exons.size(); i++) {
      |                         ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:142:56: warning: comparison of integer expressions of different signedness: ‘__gnu_cxx::__alloc_traits<std::allocator<unsigned int>, unsigned int>::value_type’ {aka ‘unsigned int’} and ‘int’ [-Wsign-compare]
  142 |       if (j == (len2 - 1) && dist_holder[i * len2 + j] < best) {
main-functions/flexiplex.cpp: In function ‘void refine_matched_segments(const std::string&, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_set<std::__cxx11::basic_string<char> > >*, const std::vector<int>&, Barcode&, std::vector<int>&, std::vector<int>&)’:
main-functions/flexiplex.cpp:348:70: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
  348 |         } else if (editDistance < best_edit_distance && editDistance <= s.max_edit_distance) {
      |                                                         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:356:30: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘const int’ [-Wsign-compare]
  356 |       if (best_edit_distance <= s.max_edit_distance && current_segment_unambiguous) {
      |           ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, BGZF*, bool, bool, bool, const std::vector<Segment>&, const std::unordered_map<std::__cxx11::basic_string<char>, BarcodeGroup>&)’:
main-functions/flexiplex.cpp:790:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
  790 |   for (int b = 0; b < vec_size; b++) {
      |                   ~~^~~~~~~~~~
main-functions/flexiplex.cpp:803:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const size_t’ {aka ‘const long unsigned int’} [-Wsign-compare]
  803 |     for (int k = 0; k < vec_size; k++) {
      |                     ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   87 |     while (i < seq.size()) {
      |            ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
   88 |         if (i + wrap_len > seq.size()) {
      |             ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  255 |         for (int i = 0; i < s.size(); i++) {
      |                         ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’:
main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  268 |   for (int i = 0; i < BASES.size(); i++) {
      |                   ~~^~~~~~~~~~~~~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’:
main-functions/pileup_readid.cpp:342:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
   86 |   unsigned int end;
      |                ^~~
main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’:
main-functions/pileup_readid.cpp:344:30:   required from here
main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable]
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -std=gnu2x -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/testthat/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.23-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.23-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.23-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-g -O2  -Wall -Werror=format-security -Wno-unused-result" minimap2)
make[1]: Entering directory '/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/submodule/minimap2'
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  main.c -o main.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kthread.c -o kthread.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  kalloc.c -o kalloc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  misc.c -o misc.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  bseq.c -o bseq.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sketch.c -o sketch.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  sdust.c -o sdust.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  options.c -o options.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  index.c -o index.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  lchain.c -o lchain.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  align.c -o align.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  hit.c -o hit.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  seed.c -o seed.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  jump.c -o jump.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  map.c -o map.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  format.c -o format.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  pe.c -o pe.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  esterr.c -o esterr.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -DHAVE_KALLOC  splitidx.c -o splitidx.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -DHAVE_KALLOC  ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -g -O2  -Wall -Werror=format-security -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
ar: `u' modifier ignored since `D' is the default (see `U')
cc -g -O2  -Wall -Werror=format-security -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
make[1]: Leaving directory '/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/submodule/minimap2'
echo "Installing binary to /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
    Updating crates.io index
 Downloading crates ...
  Downloaded oarfish v0.8.0
  Installing oarfish v0.8.0
    Updating crates.io index
     Locking 279 packages to latest compatible versions
      Adding generic-array v0.14.7 (available: v0.14.9)
      Adding indicatif v0.17.11 (available: v0.18.4)
      Adding needletail v0.6.3 (available: v0.7.3)
      Adding noodles-bam v0.78.0 (available: v0.88.0)
      Adding noodles-bgzf v0.38.0 (available: v0.46.0)
      Adding noodles-sam v0.74.0 (available: v0.84.0)
      Adding rand v0.9.4 (available: v0.10.1)
      Adding tabled v0.18.0 (available: v0.20.0)
      Adding typed-builder v0.21.2 (available: v0.23.2)
 Downloading crates ...
  Downloaded futures-task v0.3.32
  Downloaded adler2 v2.0.1
  Downloaded alga v0.9.3
  Downloaded lazy_static v1.5.0
  Downloaded anstream v1.0.0
  Downloaded anstyle-query v1.1.5
  Downloaded paste v1.0.15
  Downloaded crossbeam-queue v0.3.12
  Downloaded futures-macro v0.3.32
  Downloaded futures-io v0.3.32
  Downloaded once_cell v1.21.4
  Downloaded find-msvc-tools v0.1.9
  Downloaded array-init-cursor v0.2.1
  Downloaded fnv v1.0.7
  Downloaded hex v0.4.3
  Downloaded seq-macro v0.3.6
  Downloaded kders v0.1.1
  Downloaded crypto-common v0.1.7
  Downloaded heck v0.5.0
  Downloaded rawpointer v0.2.1
  Downloaded parse-size v1.1.0
  Downloaded matchers v0.2.0
  Downloaded crossbeam v0.8.4
  Downloaded cfg-if v1.0.4
  Downloaded itoa v1.0.18
  Downloaded rand_chacha v0.3.1
  Downloaded atomic_float v1.1.0
  Downloaded num v0.4.3
  Downloaded errno v0.3.14
  Downloaded block-buffer v0.10.4
  Downloaded sha2-asm v0.6.4
  Downloaded number_prefix v0.4.0
  Downloaded cpufeatures v0.2.17
  Downloaded clap_lex v1.1.0
  Downloaded hash_hasher v2.0.4
  Downloaded proc-macro-error-attr2 v2.0.0
  Downloaded generic-array v0.14.7
  Downloaded colorchoice v1.0.5
  Downloaded async-stream-impl v0.3.6
  Downloaded is_terminal_polyfill v1.70.2
  Downloaded futures-executor v0.3.32
  Downloaded anstyle-parse v1.0.0
  Downloaded futures-core v0.3.32
  Downloaded futures-sink v0.3.32
  Downloaded noodles-core v0.17.0
  Downloaded async-stream v0.3.6
  Downloaded strsim v0.11.1
  Downloaded foreign_vec v0.1.0
  Downloaded tabled_derive v0.10.0
  Downloaded approx v0.3.2
  Downloaded approx v0.5.1
  Downloaded num-iter v0.1.45
  Downloaded equivalent v1.0.2
  Downloaded dyn-clone v1.0.20
  Downloaded rustc_version v0.4.1
  Downloaded fallible-streaming-iterator v0.1.9
  Downloaded lz4 v1.28.1
  Downloaded either v1.15.0
  Downloaded bytemuck_derive v1.10.2
  Downloaded derive-new v0.6.0
  Downloaded bytecount v0.6.9
  Downloaded simd-adler32 v0.3.9
  Downloaded rustc-hash v2.1.2
  Downloaded autocfg v1.5.0
  Downloaded streaming-iterator v0.1.9
  Downloaded rustversion v1.0.22
  Downloaded digest v0.10.7
  Downloaded num-integer v0.1.46
  Downloaded num-complex v0.2.4
  Downloaded arrayvec v0.7.6
  Downloaded crossbeam-deque v0.8.6
  Downloaded strum_macros v0.26.4
  Downloaded bit-vec v0.8.0
  Downloaded anstyle v1.0.14
  Downloaded buffer-redux v1.1.0
  Downloaded num_cpus v1.17.0
  Downloaded crc32fast v1.5.0
  Downloaded streaming-decompression v0.1.2
  Downloaded sendable-swapvec v0.4.3
  Downloaded path-tools v0.1.0
  Downloaded async-trait v0.1.89
  Downloaded ppv-lite86 v0.2.21
  Downloaded csv-core v0.1.13
  Downloaded noisy_float v0.2.1
  Downloaded num-complex v0.4.6
  Downloaded thiserror v1.0.69
  Downloaded pkg-config v0.3.33
  Downloaded rand_core v0.9.5
  Downloaded num-rational v0.4.2
  Downloaded fastrand v2.4.1
  Downloaded clap_derive v4.6.1
  Downloaded crossbeam-utils v0.8.21
  Downloaded lexical-parse-integer v1.0.6
  Downloaded bio-types v1.0.4
  Downloaded ahash v0.8.12
  Downloaded slab v0.4.12
  Downloaded getrandom v0.3.4
  Downloaded static_assertions v1.1.0
  Downloaded nu-ansi-term v0.50.3
  Downloaded futures-channel v0.3.32
  Downloaded quote v1.0.45
  Downloaded lexical-core v1.0.6
  Downloaded byteorder v1.5.0
  Downloaded console v0.15.11
  Downloaded serde_core v1.0.228
  Downloaded sha2 v0.10.9
  Downloaded ethnum v1.5.3
  Downloaded arrow-format v0.8.1
  Downloaded semver v1.0.28
  Downloaded rand_core v0.6.4
  Downloaded getrandom v0.2.17
  Downloaded lexical-write-integer v1.0.6
  Downloaded proc-macro-error2 v2.0.1
  Downloaded version_check v0.9.5
  Downloaded shlex v1.3.0
  Downloaded seqcol_rs v0.4.1
  Downloaded zstd-safe v6.0.6
  Downloaded zmij v1.0.21
  Downloaded utf8parse v0.2.2
  Downloaded rand_chacha v0.9.0
  Downloaded log v0.4.29
  Downloaded clap v4.6.1
  Downloaded zstd v0.13.3
  Downloaded serde_derive v1.0.228
  Downloaded twox-hash v1.6.3
  Downloaded rand_distr v0.4.3
  Downloaded bytemuck v1.25.0
  Downloaded futures v0.3.32
  Downloaded tracing-log v0.2.0
  Downloaded zstd-safe v7.2.4
  Downloaded smallvec v1.15.1
  Downloaded zstd v0.12.4
  Downloaded papergrid v0.14.0
  Downloaded indicatif v0.17.11
  Downloaded snap v1.1.1
  Downloaded crossbeam-channel v0.5.15
  Downloaded cc v1.2.60
  Downloaded rayon-core v1.13.0
  Downloaded miniz_oxide v0.8.9
  Downloaded bytes v1.11.1
  Downloaded num-format v0.4.4
  Downloaded tracing-core v0.1.36
  Downloaded indexmap v2.14.0
  Downloaded ryu v1.0.23
  Downloaded proc-macro2 v1.0.106
  Downloaded unicode-ident v1.0.24
  Downloaded simba v0.9.1
  Downloaded tracing-attributes v0.1.31
  Downloaded safe_arch v0.7.4
  Downloaded memchr v2.8.0
  Downloaded parquet-format-safe v0.2.4
  Downloaded noodles-bgzf v0.38.0
  Downloaded ndarray-stats v0.6.0
  Downloaded typenum v1.20.0
  Downloaded lexical-util v1.0.7
  Downloaded serde v1.0.228
  Downloaded itertools v0.13.0
  Downloaded noodles-csi v0.46.0
  Downloaded rand v0.9.4
  Downloaded hashbrown v0.14.5
  Downloaded simdutf8 v0.1.5
  Downloaded hashbrown v0.17.0
  Downloaded futures-util v0.3.32
  Downloaded sprs v0.11.4
  Downloaded lexical-parse-float v1.0.6
  Downloaded num-bigint v0.4.6
  Downloaded clap_builder v4.6.0
  Downloaded lexical-write-float v1.0.6
  Downloaded itertools v0.14.0
  Downloaded aho-corasick v1.1.4
  Downloaded rand v0.8.6
  Downloaded noodles-sam v0.74.0
  Downloaded chrono v0.4.44
  Downloaded wide v0.7.33
  Downloaded tabled v0.18.0
  Downloaded vcpkg v0.2.15
  Downloaded statrs v0.18.0
  Downloaded bstr v1.12.1
  Downloaded regex v1.12.3
  Downloaded portable-atomic v1.13.1
  Downloaded libm v0.2.16
  Downloaded rayon v1.12.0
  Downloaded syn v2.0.117
  Downloaded tracing-subscriber v0.3.23
  Downloaded serde_json v1.0.149
  Downloaded zlib-rs v0.6.3
  Downloaded ndarray v0.17.2
  Downloaded nalgebra v0.33.3
  Downloaded tracing v0.1.44
  Downloaded unicode-width v0.2.2
  Downloaded ndarray v0.16.1
  Downloaded ndarray v0.15.6
  Downloaded zerocopy v0.8.48
  Downloaded noodles-bam v0.78.0
  Downloaded regex-syntax v0.8.10
  Downloaded bzip2-sys v0.1.13+1.0.8
  Downloaded base64 v0.21.7
  Downloaded flate2 v1.1.9
  Downloaded base64 v0.22.1
  Downloaded planus v0.3.1
  Downloaded matrixmultiply v0.3.10
  Downloaded typed-builder-macro v0.21.2
  Downloaded thiserror-impl v1.0.69
  Downloaded sharded-slab v0.1.7
  Downloaded csv v1.4.0
  Downloaded minimap2-sys v0.1.30+minimap2.2.30
  Downloaded arrow2 v0.18.0
  Downloaded needletail v0.6.3
  Downloaded rustix v1.1.4
  Downloaded parquet2 v0.17.2
  Downloaded lz4-sys v1.11.1+lz4-1.10.0
  Downloaded tempfile v3.27.0
  Downloaded num-traits v0.2.19
  Downloaded minimap2 v0.1.31+minimap2.2.30
  Downloaded getrandom v0.4.2
  Downloaded typed-builder v0.21.2
  Downloaded thread_local v1.1.9
  Downloaded lz4_flex v0.10.0
  Downloaded liblzma v0.3.6
  Downloaded regex-automata v0.4.14
  Downloaded anyhow v1.0.102
  Downloaded crossbeam-epoch v0.9.18
  Downloaded bitflags v2.11.1
  Downloaded jobserver v0.1.34
  Downloaded bzip2 v0.4.4
  Downloaded pin-project-lite v0.2.17
  Downloaded bincode v1.3.3
  Downloaded zstd-sys v2.0.16+zstd.1.5.7
  Downloaded libc v0.2.185
  Downloaded libz-sys v1.1.28
  Downloaded liblzma-sys v0.3.13
  Downloaded linux-raw-sys v0.12.1
   Compiling libc v0.2.185
   Compiling proc-macro2 v1.0.106
   Compiling unicode-ident v1.0.24
   Compiling quote v1.0.45
   Compiling shlex v1.3.0
   Compiling find-msvc-tools v0.1.9
   Compiling cfg-if v1.0.4
   Compiling autocfg v1.5.0
   Compiling pkg-config v0.3.33
   Compiling libm v0.2.16
   Compiling memchr v2.8.0
   Compiling zerocopy v0.8.48
   Compiling crossbeam-utils v0.8.21
   Compiling version_check v0.9.5
   Compiling once_cell v1.21.4
   Compiling adler2 v2.0.1
   Compiling simd-adler32 v0.3.9
   Compiling crc32fast v1.5.0
   Compiling regex-syntax v0.8.10
   Compiling serde_core v1.0.228
   Compiling pin-project-lite v0.2.17
   Compiling zlib-rs v0.6.3
   Compiling rawpointer v0.2.1
   Compiling hashbrown v0.17.0
   Compiling either v1.15.0
   Compiling futures-core v0.3.32
   Compiling typenum v1.20.0
   Compiling equivalent v1.0.2
   Compiling getrandom v0.3.4
   Compiling futures-sink v0.3.32
   Compiling lexical-util v1.0.7
   Compiling serde v1.0.228
   Compiling paste v1.0.15
   Compiling vcpkg v0.2.15
   Compiling zstd-safe v7.2.4
   Compiling futures-task v0.3.32
   Compiling heck v0.5.0
   Compiling slab v0.4.12
   Compiling futures-io v0.3.32
   Compiling zstd-safe v6.0.6
   Compiling bitflags v2.11.1
   Compiling bytecount v0.6.9
   Compiling rustversion v1.0.22
   Compiling anyhow v1.0.102
   Compiling semver v1.0.28
   Compiling rustix v1.1.4
   Compiling itoa v1.0.18
   Compiling byteorder v1.5.0
   Compiling snap v1.1.1
   Compiling rayon-core v1.13.0
   Compiling utf8parse v0.2.2
   Compiling bytes v1.11.1
   Compiling unicode-width v0.2.2
   Compiling zmij v1.0.21
   Compiling lazy_static v1.5.0
   Compiling getrandom v0.4.2
   Compiling anstyle-query v1.1.5
   Compiling portable-atomic v1.13.1
   Compiling array-init-cursor v0.2.1
   Compiling thiserror v1.0.69
   Compiling fallible-streaming-iterator v0.1.9
   Compiling static_assertions v1.1.0
   Compiling smallvec v1.15.1
   Compiling is_terminal_polyfill v1.70.2
   Compiling linux-raw-sys v0.12.1
   Compiling log v0.4.29
   Compiling bit-vec v0.8.0
   Compiling anstyle v1.0.14
   Compiling serde_json v1.0.149
   Compiling colorchoice v1.0.5
   Compiling fastrand v2.4.1
   Compiling nu-ansi-term v0.50.3
   Compiling thread_local v1.1.9
   Compiling clap_lex v1.1.0
   Compiling strsim v0.11.1
   Compiling fnv v1.0.7
   Compiling cpufeatures v0.2.17
   Compiling miniz_oxide v0.8.9
   Compiling tracing-core v0.1.36
   Compiling seq-macro v0.3.6
   Compiling arrayvec v0.7.6
   Compiling streaming-iterator v0.1.9
   Compiling sharded-slab v0.1.7
   Compiling planus v0.3.1
   Compiling generic-array v0.14.7
   Compiling ahash v0.8.12
   Compiling streaming-decompression v0.1.2
   Compiling itertools v0.13.0
   Compiling twox-hash v1.6.3
   Compiling itertools v0.14.0
   Compiling hash_hasher v2.0.4
   Compiling num-traits v0.2.19
   Compiling matrixmultiply v0.3.10
   Compiling num-complex v0.2.4
   Compiling anstyle-parse v1.0.0
   Compiling base64 v0.22.1
   Compiling hex v0.4.3
   Compiling foreign_vec v0.1.0
   Compiling number_prefix v0.4.0
   Compiling futures-channel v0.3.32
   Compiling simdutf8 v0.1.5
   Compiling dyn-clone v1.0.20
   Compiling ethnum v1.5.3
   Compiling base64 v0.21.7
   Compiling ryu v1.0.23
   Compiling path-tools v0.1.0
   Compiling rustc-hash v2.1.2
   Compiling aho-corasick v1.1.4
   Compiling lexical-parse-integer v1.0.6
   Compiling lexical-write-integer v1.0.6
   Compiling rustc_version v0.4.1
   Compiling buffer-redux v1.1.0
   Compiling csv-core v0.1.13
   Compiling papergrid v0.14.0
   Compiling anstream v1.0.0
   Compiling num-format v0.4.4
   Compiling atomic_float v1.1.0
   Compiling parse-size v1.1.0
   Compiling lz4_flex v0.10.0
   Compiling tracing-log v0.2.0
   Compiling lexical-parse-float v1.0.6
   Compiling arrow2 v0.18.0
   Compiling indexmap v2.14.0
   Compiling clap_builder v4.6.0
   Compiling lexical-write-float v1.0.6
   Compiling crossbeam-epoch v0.9.18
   Compiling crossbeam-channel v0.5.15
   Compiling crossbeam-queue v0.3.12
   Compiling crossbeam-deque v0.8.6
   Compiling lexical-core v1.0.6
   Compiling syn v2.0.117
   Compiling proc-macro-error-attr2 v2.0.0
   Compiling block-buffer v0.10.4
   Compiling crypto-common v0.1.7
   Compiling jobserver v0.1.34
   Compiling crossbeam v0.8.4
   Compiling digest v0.10.7
   Compiling cc v1.2.60
   Compiling getrandom v0.2.17
   Compiling num_cpus v1.17.0
   Compiling console v0.15.11
   Compiling rayon v1.12.0
   Compiling rand_core v0.6.4
   Compiling rand_core v0.9.5
   Compiling regex-automata v0.4.14
   Compiling num-integer v0.1.46
   Compiling num-complex v0.4.6
   Compiling approx v0.5.1
   Compiling noisy_float v0.2.1
   Compiling approx v0.3.2
   Compiling chrono v0.4.44
   Compiling indicatif v0.17.11
   Compiling num-bigint v0.4.6
   Compiling num-iter v0.1.45
   Compiling tempfile v3.27.0
   Compiling alga v0.9.3
   Compiling ndarray v0.16.1
   Compiling ndarray v0.17.2
   Compiling ndarray v0.15.6
   Compiling zstd-sys v2.0.16+zstd.1.5.7
   Compiling liblzma-sys v0.3.13
   Compiling bzip2-sys v0.1.13+1.0.8
   Compiling libz-sys v1.1.28
   Compiling sha2-asm v0.6.4
   Compiling minimap2-sys v0.1.30+minimap2.2.30
   Compiling lz4-sys v1.11.1+lz4-1.10.0
   Compiling flate2 v1.1.9
   Compiling sha2 v0.10.9
   Compiling csv v1.4.0
   Compiling noodles-bgzf v0.38.0
   Compiling num-rational v0.4.2
   Compiling liblzma v0.3.6
   Compiling proc-macro-error2 v2.0.1
   Compiling num v0.4.3
   Compiling bytemuck_derive v1.10.2
   Compiling serde_derive v1.0.228
   Compiling futures-macro v0.3.32
   Compiling async-stream-impl v0.3.6
   Compiling tracing-attributes v0.1.31
   Compiling async-trait v0.1.89
   Compiling thiserror-impl v1.0.69
   Compiling derive-new v0.6.0
   Compiling tabled_derive v0.10.0
   Compiling clap_derive v4.6.1
   Compiling strum_macros v0.26.4
   Compiling typed-builder-macro v0.21.2
   Compiling ppv-lite86 v0.2.21
   Compiling async-stream v0.3.6
   Compiling hashbrown v0.14.5
   Compiling rand_chacha v0.3.1
   Compiling rand_chacha v0.9.0
   Compiling futures-util v0.3.32
   Compiling tabled v0.18.0
   Compiling rand v0.9.4
   Compiling bytemuck v1.25.0
   Compiling rand v0.8.6
   Compiling tracing v0.1.44
   Compiling typed-builder v0.21.2
   Compiling safe_arch v0.7.4
   Compiling bzip2 v0.4.4
   Compiling bstr v1.12.1
   Compiling matchers v0.2.0
   Compiling regex v1.12.3
   Compiling tracing-subscriber v0.3.23
   Compiling wide v0.7.33
   Compiling rand_distr v0.4.3
   Compiling noodles-core v0.17.0
   Compiling clap v4.6.1
   Compiling noodles-csi v0.46.0
   Compiling ndarray-stats v0.6.0
   Compiling noodles-sam v0.74.0
   Compiling kders v0.1.1
   Compiling arrow-format v0.8.1
   Compiling bincode v1.3.3
   Compiling bio-types v1.0.4
   Compiling sendable-swapvec v0.4.3
   Compiling futures-executor v0.3.32
   Compiling simba v0.9.1
   Compiling futures v0.3.32
   Compiling parquet-format-safe v0.2.4
   Compiling sprs v0.11.4
   Compiling noodles-bam v0.78.0
   Compiling lz4 v1.28.1
   Compiling nalgebra v0.33.3
   Compiling zstd v0.12.4
   Compiling zstd v0.13.3
   Compiling parquet2 v0.17.2
   Compiling needletail v0.6.3
   Compiling seqcol_rs v0.4.1
   Compiling minimap2 v0.1.31+minimap2.2.30
   Compiling statrs v0.18.0
   Compiling oarfish v0.8.0
    Finished `release` profile [optimized] target(s) in 52.80s
  Installing /home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/cargo_temp/bin/oarfish
   Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `/home/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
    Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9715983df/config_file_1114601.json
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9715983df/config_file_1114601.json
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9715983df/config_file_1114601.json
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9777872fa/config_file_1114601.json
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e93ee37bc0/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e93033150/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e93033150/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e97c4e254a/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e97c4e254a/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e97c4e254a/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e97c4e254a/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Converting legacy `pattern` argument to `segments`...
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9634030e1/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
2 transcripts found in the BAM file.
1(50%) transcripts failed the filter.
Failed transcripts account for 100 reads, out of 200(50%) reads in total.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e917307161/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:49:44 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpiVZk7q/file1101e917307161/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpiVZk7q/file1101e917307161/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpiVZk7q/file1101e917307161/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:49:46 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:50:13 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpiVZk7q/file1101e917307161/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpiVZk7q/file1101e917307161/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpiVZk7q/file1101e917307161/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Tue Apr 21 00:50:14 2026 ----------
[2m2026-04-21T04:50:14.108146Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:50:14.108689Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e917307161/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:50:14.108711Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:50:14.108719Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:50:14.108793Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:50:14.108805Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:50:14.112830Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 1 unmapped read records.
[2m2026-04-21T04:50:14.113065Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 686   │
│ aligned fraction too low        │ 16    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 4     │
│ reads with valid best alignment │ 283   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:50:14.113116Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 364
[2m2026-04-21T04:50:14.113123Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 283
[2m2026-04-21T04:50:14.113135Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 235
[2m2026-04-21T04:50:14.114147Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:50:14.124028Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:50:14.124421Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e917307161/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:50:14.124471Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:50:14.124479Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:50:14.124547Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:50:14.124561Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:50:14.128717Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 1 unmapped read records.
[2m2026-04-21T04:50:14.128970Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 695   │
│ aligned fraction too low        │ 14    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 7     │
│ reads with valid best alignment │ 285   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:50:14.129034Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 369
[2m2026-04-21T04:50:14.129041Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 285
[2m2026-04-21T04:50:14.129048Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 235
[2m2026-04-21T04:50:14.129948Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:50:14.139768Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:50:14.140183Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e917307161/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:50:14.140207Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:50:14.140242Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:50:14.140306Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:50:14.140317Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:50:14.144332Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-04-21T04:50:14.144587Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 696   │
│ aligned fraction too low        │ 14    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 284   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:50:14.144639Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 362
[2m2026-04-21T04:50:14.144646Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 284
[2m2026-04-21T04:50:14.144653Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 237
[2m2026-04-21T04:50:14.145515Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e920f6643d/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:50:14 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample1_align2genome.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample2_align2genome.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:50:36 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:50:58 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e920f6643d/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:51:19 2026 ----------
[2m2026-04-21T04:51:19.157734Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:51:19.158226Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e920f6643d/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:51:19.158249Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:51:19.158282Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:51:19.158342Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:51:19.158352Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:51:19.162510Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-04-21T04:51:19.162784Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 702   │
│ aligned fraction too low        │ 13    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 285   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:51:19.162828Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 364
[2m2026-04-21T04:51:19.162840Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 285
[2m2026-04-21T04:51:19.162848Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 238
[2m2026-04-21T04:51:19.163753Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:51:19.171935Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:51:19.172362Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e920f6643d/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:51:19.172385Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:51:19.172393Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:51:19.172467Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:51:19.172479Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:51:19.176495Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-04-21T04:51:19.176722Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 687   │
│ aligned fraction too low        │ 16    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 6     │
│ reads with valid best alignment │ 282   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:51:19.176779Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 355
[2m2026-04-21T04:51:19.176787Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 282
[2m2026-04-21T04:51:19.176802Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 240
[2m2026-04-21T04:51:19.177643Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:51:19.185610Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:51:19.186016Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e920f6643d/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:51:19.186061Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:51:19.186069Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:51:19.186125Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:51:19.186136Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:51:19.190172Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2026-04-21T04:51:19.190381Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 688   │
│ aligned fraction too low        │ 15    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 7     │
│ reads with valid best alignment │ 283   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:51:19.190428Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 354
[2m2026-04-21T04:51:19.190436Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 283
[2m2026-04-21T04:51:19.190443Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 240
[2m2026-04-21T04:51:19.191575Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e97cd1a005/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:51:19 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:51:21 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:51:41 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpiVZk7q/file1101e97cd1a005/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 00:51:42 2026 ----------
00:51:42 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9da7ec4c/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:51:44 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample1_align2genome.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample2_align2genome.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:52:07 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 5 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:52:27 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:52:47 2026 ----------
00:52:47 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/RtmpiVZk7q/file1101e97cd1a005/sample1_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e97cd1a005/sample2_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e97cd1a005/sample3_realign2transcript.bam'] /tmp/RtmpiVZk7q/file1101e97cd1a005/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 866, 'not_enough_coverage': 30, 'unmapped': 4})
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e939ac6fcf/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:52:48 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:52:49 2026 -------------
Inputs:  ['/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample1_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample2_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e9da7ec4c/sample3_realign2transcript.bam'] /tmp/RtmpiVZk7q/file1101e9da7ec4c/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 863, 'not_enough_coverage': 32, 'unmapped': 5})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:52:50 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Tue Apr 21 00:52:53 2026 ----------
[2m2026-04-21T04:52:53.134359Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:52:53.134851Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample1_realign2transcript.bam, contains 17 reference sequences.
[2m2026-04-21T04:52:53.134872Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:52:53.134880Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:52:53.134990Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:52:53.135004Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-04-21T04:52:53.145186Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:52:53.145413Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3436  │
│ aligned fraction too low        │ 7     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 293   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:52:53.145479Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 513
[2m2026-04-21T04:52:53.145493Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 293
[2m2026-04-21T04:52:53.145500Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 198
[2m2026-04-21T04:52:53.146393Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:52:53.153904Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:52:53.154272Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample2_realign2transcript.bam, contains 17 reference sequences.
[2m2026-04-21T04:52:53.154320Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:52:53.154328Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:52:53.154414Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:52:53.154435Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-04-21T04:52:53.164711Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:52:53.164942Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3402  │
│ aligned fraction too low        │ 8     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 292   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:52:53.165005Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 525
[2m2026-04-21T04:52:53.165013Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 292
[2m2026-04-21T04:52:53.165019Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 190
[2m2026-04-21T04:52:53.165911Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:52:53.173464Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:52:53.173836Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e939ac6fcf/sample3_realign2transcript.bam, contains 17 reference sequences.
[2m2026-04-21T04:52:53.173888Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:52:53.173896Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:52:53.173997Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:52:53.174012Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 17 transcripts.
[2m2026-04-21T04:52:53.184359Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:52:53.184584Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3342  │
│ aligned fraction too low        │ 10    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 290   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:52:53.184645Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 517
[2m2026-04-21T04:52:53.184652Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 290
[2m2026-04-21T04:52:53.184658Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 192
[2m2026-04-21T04:52:53.185661Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9744ed9e9/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:52:53 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample1_align2genome.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample2_align2genome.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:53:15 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:53:16 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e9744ed9e9/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:53:38 2026 ----------
[2m2026-04-21T04:53:38.119538Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:53:38.120017Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9744ed9e9/sample1_realign2transcript.bam, contains 15 reference sequences.
[2m2026-04-21T04:53:38.120040Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:53:38.120048Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:53:38.120136Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:53:38.120168Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-04-21T04:53:38.129546Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:53:38.129801Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 3045  │
│ aligned fraction too low        │ 7     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 293   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:53:38.129869Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 495
[2m2026-04-21T04:53:38.129877Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 293
[2m2026-04-21T04:53:38.129891Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 208
[2m2026-04-21T04:53:38.130903Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:53:38.142391Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:53:38.142756Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9744ed9e9/sample2_realign2transcript.bam, contains 15 reference sequences.
[2m2026-04-21T04:53:38.142803Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:53:38.142811Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:53:38.142900Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:53:38.142915Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-04-21T04:53:38.152318Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:53:38.152565Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 2896  │
│ aligned fraction too low        │ 10    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 290   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:53:38.152635Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 511
[2m2026-04-21T04:53:38.152642Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 290
[2m2026-04-21T04:53:38.152650Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 198
[2m2026-04-21T04:53:38.153539Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2026-04-21T04:53:38.164966Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:53:38.165354Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9744ed9e9/sample3_realign2transcript.bam, contains 15 reference sequences.
[2m2026-04-21T04:53:38.165373Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:53:38.165406Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:53:38.165488Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:53:38.165503Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 15 transcripts.
[2m2026-04-21T04:53:38.174666Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2026-04-21T04:53:38.174962Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 2880  │
│ aligned fraction too low        │ 9     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 291   │
╰─────────────────────────────────┴───────╯

[2m2026-04-21T04:53:38.175014Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 496
[2m2026-04-21T04:53:38.175029Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 291
[2m2026-04-21T04:53:38.175035Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 206
[2m2026-04-21T04:53:38.175895Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e97ee8ecd2/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:53:38 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:53:40 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:53:40 2026 -------------------
Realigning sample sample1 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 00:53:42 2026 ----------
00:53:42 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e930bf0fe8/config_file_1114601.json
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Tue Apr 21 00:53:43 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample1_align2genome.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample2_align2genome.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample3_align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:54:07 2026 -------------
Inputs:  ['/tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample1_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample2_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e97ee8ecd2/sample3_realign2transcript.bam'] /tmp/RtmpiVZk7q/file1101e97ee8ecd2/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:54:07 2026 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:54:27 2026 ----------
00:54:27 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e944db1a89/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:54:28 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e944db1a89/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:54:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e944db1a89/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e944db1a89/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:54:29 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:54:38 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e944db1a89/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e944db1a89/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpiVZk7q/file1101e944db1a89/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e944db1a89/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Tue Apr 21 00:54:38 2026 ----------
[2m2026-04-21T04:54:39.012510Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:54:39.013087Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e944db1a89/realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:54:39.013150Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:54:39.013158Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:54:39.013214Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:54:39.013226Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:54:39.020298Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e96fae210b/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:54:39 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96fae210b/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:54:39 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e96fae210b/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96fae210b/align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:54:59 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:55:09 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96fae210b/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96fae210b/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e96fae210b/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96fae210b/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:55:28 2026 ----------
[2m2026-04-21T04:55:28.538830Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:55:28.539263Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96fae210b/realign2transcript.bam, contains 5 reference sequences.
[2m2026-04-21T04:55:28.539287Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:55:28.539330Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:55:28.539391Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:55:28.539402Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2026-04-21T04:55:28.546393Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e93d1f56/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:55:29 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e93d1f56/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:55:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e93d1f56/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e93d1f56/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:55:29 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:55:39 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e93d1f56/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e93d1f56/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpiVZk7q/file1101e93d1f56/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e93d1f56/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 00:55:39 2026 ----------
00:55:39 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Inputs:  ['/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample1_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample2_realign2transcript.bam', '/tmp/RtmpiVZk7q/file1101e930bf0fe8/sample3_realign2transcript.bam'] /tmp/RtmpiVZk7q/file1101e930bf0fe8/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 895, 'not_enough_coverage': 5})
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e958081b4e/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:55:40 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e958081b4e/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:55:40 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e958081b4e/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e958081b4e/align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:55:59 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:56:10 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e958081b4e/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e958081b4e/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e958081b4e/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e958081b4e/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:56:29 2026 ----------
00:56:29 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e959e0251c/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:56:30 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e959e0251c/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:56:30 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e959e0251c/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e959e0251c/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:56:30 2026 -------------
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:56:31 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e959e0251c/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e959e0251c/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpiVZk7q/file1101e959e0251c/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e959e0251c/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Tue Apr 21 00:56:31 2026 ----------
[2m2026-04-21T04:56:31.389061Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:56:31.389525Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e959e0251c/realign2transcript.bam, contains 10 reference sequences.
[2m2026-04-21T04:56:31.389582Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:56:31.389591Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:56:31.389658Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:56:31.389672Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2026-04-21T04:56:31.399992Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9557a613c/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:56:32 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9557a613c/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:56:32 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9557a613c/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9557a613c/align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:56:51 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:56:52 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9557a613c/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9557a613c/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9557a613c/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9557a613c/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:57:11 2026 ----------
[2m2026-04-21T04:57:11.343876Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:57:11.344372Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9557a613c/realign2transcript.bam, contains 10 reference sequences.
[2m2026-04-21T04:57:11.344395Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:57:11.344404Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:57:11.344506Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:57:11.344519Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2026-04-21T04:57:11.355447Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e944ac81d3/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:57:12 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e944ac81d3/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:57:12 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e944ac81d3/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e944ac81d3/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Tue Apr 21 00:57:12 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:57:13 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e944ac81d3/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e944ac81d3/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpiVZk7q/file1101e944ac81d3/matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e944ac81d3/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 00:57:13 2026 ----------
00:57:13 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9500e1db9/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:57:14 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9500e1db9/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:57:14 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9500e1db9/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9500e1db9/align2genome.bam
-- Running step: isoform_identification @ Tue Apr 21 00:57:33 2026 -------------
	Counter({'counted_reads': 368, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 00:57:33 2026 -------------------
Checking for fastq file(s) /home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9500e1db9/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9500e1db9/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9500e1db9/matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9500e1db9/realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:57:51 2026 ----------
00:57:51 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e95220d653/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:57:53 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e95220d653/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 927
Number of chimera reads: 3
All done!
Reads	Barcodes
26	1
23	3
22	1
21	3
20	1
19	1
18	1
16	2
15	1
14	2
13	3
12	5
11	2
10	6
9	9
8	3
7	6
6	11
5	8
4	8
3	39
2	19
1	2
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e95220d653/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	5
6	2
5	7
4	5
3	19
2	27
1	53
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e95220d653/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
7	5
6	4
5	1
4	15
3	12
2	23
1	65
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e95220d653/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:57:54 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample1_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample2_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample3_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Apr 21 00:57:58 2026 ----------------
00:57:58 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e95220d653/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e95220d653/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e95220d653/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e95220d653/sample3_align2genome.bam'
	Counter({'counted_reads': 368, 'unmapped': 4})
parsing /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.62gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 171355.55Read/s]
parsing /tmp/RtmpiVZk7q/file1101e95220d653/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 536740.38Read/s]
parsing /tmp/RtmpiVZk7q/file1101e95220d653/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.83gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 500179.36Read/s]
parsing /tmp/RtmpiVZk7q/file1101e95220d653/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.36gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 388131.48Read/s]
-- Running step: isoform_identification @ Tue Apr 21 00:58:00 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 7 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:58:24 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e95220d653/fastq, /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e95220d653/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e95220d653/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e95220d653/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Tue Apr 21 00:58:26 2026 ----------
[2m2026-04-21T04:58:26.382220Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:58:26.382730Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e95220d653/sampleA_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:58:26.382793Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:58:26.382801Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:58:26.382860Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:58:26.382885Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:58:26.394132Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:58:26.715932Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:58:26.716318Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e95220d653/sample1_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:58:26.716376Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:58:26.716385Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:58:26.716442Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:58:26.716453Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:58:26.722248Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:58:27.017432Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:58:27.017959Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e95220d653/sample2_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:58:27.018025Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:58:27.018034Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:58:27.018096Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:58:27.018108Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:58:27.023482Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:58:27.318385Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:58:27.318910Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e95220d653/sample3_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:58:27.318936Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:58:27.318989Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:58:27.319051Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:58:27.319063Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:58:27.324777Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9340986a/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:58:27 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9340986a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 930
Number of chimera reads: 3
All done!
Reads	Barcodes
28	1
25	1
23	3
22	1
21	1
19	2
18	1
17	1
16	2
15	2
14	2
13	4
12	2
11	5
10	4
9	7
8	7
7	2
6	11
5	12
4	7
3	37
2	20
1	2
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9340986a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads	Barcodes
10	1
9	1
8	3
7	2
6	4
5	7
4	6
3	15
2	21
1	60
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9340986a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	3
6	1
5	6
4	9
3	19
2	29
1	56
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9340986a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:58:29 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9340986a/sampleA_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sampleA_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample1_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample1_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample2_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample2_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample3_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Apr 21 00:58:51 2026 ----------------
00:58:51 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e9340986a/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9340986a/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9340986a/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e9340986a/sample3_align2genome.bam'
parsing /tmp/RtmpiVZk7q/file1101e9340986a/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.90gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 158039.46Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9340986a/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.73gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 515245.44Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9340986a/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.18gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 542881.70Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9340986a/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.38gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 424507.51Read/s]
-- Running step: isoform_identification @ Tue Apr 21 00:58:52 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 00:59:20 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9340986a/fastq, /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9340986a/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9340986a/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9340986a/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9340986a/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sampleA_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample1_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample2_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9340986a/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9340986a/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 00:59:40 2026 ----------
[2m2026-04-21T04:59:40.831723Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:59:40.832129Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9340986a/sampleA_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:59:40.832203Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:59:40.832212Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:59:40.832278Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:59:40.832290Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:59:40.843216Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:59:41.200434Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:59:41.200824Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9340986a/sample1_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:59:41.200889Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:59:41.200898Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:59:41.200957Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:59:41.200968Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:59:41.206281Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:59:41.512328Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:59:41.512727Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9340986a/sample2_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:59:41.512750Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:59:41.512804Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:59:41.512862Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:59:41.512875Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:59:41.518494Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T04:59:41.825718Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T04:59:41.826331Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e9340986a/sample3_realign2transcript.bam, contains 6 reference sequences.
[2m2026-04-21T04:59:41.826352Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T04:59:41.826411Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T04:59:41.826466Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T04:59:41.826477Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 6 transcripts.
[2m2026-04-21T04:59:41.832183Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e949e73e64/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 00:59:42 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e949e73e64/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads	Barcodes
27	1
26	1
24	1
22	2
21	1
20	3
19	1
18	1
17	2
16	2
15	2
14	1
12	1
11	7
10	5
9	5
8	9
7	5
6	13
5	11
4	5
3	33
2	22
1	3
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e949e73e64/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	3
7	2
6	5
5	3
4	9
3	13
2	31
1	55
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e949e73e64/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
9	1
8	3
7	1
6	5
5	5
4	6
3	18
2	30
1	50
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e949e73e64/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 00:59:43 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Apr 21 00:59:47 2026 ----------------
00:59:47 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e949e73e64/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e949e73e64/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e949e73e64/sample3_align2genome.bam'
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.20gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 153473.35Read/s]
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 516489.02Read/s]
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.17gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 506069.50Read/s]
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 395524.88Read/s]
-- Running step: isoform_identification @ Tue Apr 21 00:59:48 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 01:00:11 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e949e73e64/fastq, /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 01:00:13 2026 ----------
01:00:13 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e949e73e64/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e949e73e64/sample1_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e949e73e64/sample2_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e949e73e64/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e949e73e64/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e97b7246c6/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 01:00:15 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e97b7246c6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 924
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
25	1
22	1
21	3
20	2
19	2
18	1
17	4
16	1
15	1
14	1
13	1
12	1
11	7
10	5
9	3
8	11
7	3
6	5
5	19
4	7
3	35
2	19
1	3
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e97b7246c6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 279
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	3
6	5
5	8
4	7
3	11
2	23
1	66
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e97b7246c6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 277
Number of chimera reads: 0
All done!
Reads	Barcodes
8	1
7	3
6	8
5	5
4	4
3	19
2	22
1	60
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e97b7246c6/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 01:00:16 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_align2genome.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_align2genome.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_align2genome.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Apr 21 01:00:38 2026 ----------------
01:00:38 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
	Counter({'counted_reads': 262, 'not_enough_coverage': 8, 'unmapped': 2})
	Counter({'counted_reads': 264, 'not_enough_coverage': 8, 'unmapped': 1})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.78gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 151294.39Read/s]
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.90gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 510380.14Read/s]
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.74gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 547045.08Read/s]
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.79gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 399731.63Read/s]
-- Running step: isoform_identification @ Tue Apr 21 01:00:39 2026 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 8 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Tue Apr 21 01:01:02 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq, /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 01:01:23 2026 ----------
01:01:23 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e97b7246c6/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e97b7246c6/sample1_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e97b7246c6/sample2_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_realign2transcript.bam...
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 5})
	Counter({'counted_reads': 265, 'not_enough_coverage': 8, 'unmapped': 2})
	Counter({'counted_reads': 261, 'not_enough_coverage': 9, 'unmapped': 1})
parsing /tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e97b7246c6/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e96b30a0ae/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 01:01:25 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b30a0ae/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads	Barcodes
28	1
26	1
21	2
20	3
19	4
17	2
14	4
13	2
12	5
11	7
10	1
9	6
8	4
7	7
6	12
5	15
4	4
3	35
2	19
1	3
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b30a0ae/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	4
6	3
5	5
4	8
3	12
2	36
1	54
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b30a0ae/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 0
All done!
Reads	Barcodes
9	2
7	1
6	4
5	8
4	14
3	9
2	27
1	59
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b30a0ae/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 01:01:26 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Apr 21 01:01:30 2026 ----------------
01:01:30 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
parsing /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.64gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 159895.09Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 29.44gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 524052.18Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.97gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 526446.43Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.59gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 416829.38Read/s]
-- Running step: isoform_identification @ Tue Apr 21 01:01:31 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 01:01:32 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq, /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Tue Apr 21 01:01:39 2026 ----------
[2m2026-04-21T05:01:39.671103Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:01:39.671530Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b30a0ae/sampleA_realign2transcript.bam, contains 27 reference sequences.
[2m2026-04-21T05:01:39.671555Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:01:39.671564Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:01:39.671961Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:01:39.671986Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-04-21T05:01:39.714889Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:01:40.315217Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:01:40.315726Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample1_realign2transcript.bam, contains 27 reference sequences.
[2m2026-04-21T05:01:40.315755Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:01:40.315765Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:01:40.315891Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:01:40.315912Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-04-21T05:01:40.331853Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:01:40.903956Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:01:40.904514Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample2_realign2transcript.bam, contains 27 reference sequences.
[2m2026-04-21T05:01:40.904538Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:01:40.904548Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:01:40.904670Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:01:40.904699Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-04-21T05:01:40.921063Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:01:41.498557Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:01:41.498962Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b30a0ae/sample3_realign2transcript.bam, contains 27 reference sequences.
[2m2026-04-21T05:01:41.498988Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:01:41.498996Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:01:41.499109Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:01:41.499128Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 27 transcripts.
[2m2026-04-21T05:01:41.517367Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e96b4bcb80/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 01:01:42 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b4bcb80/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 932
Number of chimera reads: 3
All done!
Reads	Barcodes
26	1
25	1
24	1
22	2
21	1
20	4
19	1
18	1
15	3
14	1
13	1
12	3
11	9
10	5
9	5
8	6
7	3
6	15
5	10
4	6
3	37
2	20
1	1
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b4bcb80/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 1
All done!
Reads	Barcodes
8	2
7	4
6	5
5	2
4	9
3	18
2	27
1	56
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b4bcb80/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 284
Number of chimera reads: 1
All done!
Reads	Barcodes
8	3
7	4
6	4
5	3
4	9
3	17
2	26
1	58
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e96b4bcb80/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 01:01:43 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_align2genome.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_align2genome.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_align2genome.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Apr 21 01:02:05 2026 ----------------
01:02:05 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_align2genome.bam'
parsing /tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.18gene_group/s]
/home/biocbuild/bbs-3.23-bioc/R/site-library/FLAMES/python/count_gene.py:702: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 155211.23Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.37gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 524261.79Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.07gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 528942.70Read/s]
parsing /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.51gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 404449.59Read/s]
-- Running step: isoform_identification @ Tue Apr 21 01:02:07 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 01:02:07 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq, /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 01:02:34 2026 ----------
[2m2026-04-21T05:02:34.654180Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:02:34.654613Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b4bcb80/sampleA_realign2transcript.bam, contains 28 reference sequences.
[2m2026-04-21T05:02:34.654640Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:02:34.654649Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:02:34.654783Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:02:34.654804Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-04-21T05:02:34.697329Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:02:35.348497Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:02:35.348923Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample1_realign2transcript.bam, contains 28 reference sequences.
[2m2026-04-21T05:02:35.348951Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:02:35.348962Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:02:35.349090Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:02:35.349114Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-04-21T05:02:35.364491Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:02:35.976452Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:02:35.976903Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample2_realign2transcript.bam, contains 28 reference sequences.
[2m2026-04-21T05:02:35.976930Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:02:35.976940Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:02:35.977060Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:02:35.977080Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-04-21T05:02:35.992797Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2026-04-21T05:02:36.535222Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2026-04-21T05:02:36.535805Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpiVZk7q/file1101e96b4bcb80/sample3_realign2transcript.bam, contains 28 reference sequences.
[2m2026-04-21T05:02:36.535829Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2026-04-21T05:02:36.535838Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2026-04-21T05:02:36.535954Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2026-04-21T05:02:36.535973Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 28 transcripts.
[2m2026-04-21T05:02:36.555264Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9724ddef7/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 01:02:37 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9724ddef7/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 928
Number of chimera reads: 2
All done!
Reads	Barcodes
26	1
23	2
22	1
21	1
20	2
19	2
18	4
16	2
15	1
14	1
13	1
12	5
11	6
10	5
9	4
8	7
7	3
6	15
5	11
4	2
3	35
2	23
1	3
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9724ddef7/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 278
Number of chimera reads: 0
All done!
Reads	Barcodes
7	4
6	3
5	9
4	11
3	13
2	23
1	59
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9724ddef7/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 282
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	1
7	5
6	2
5	8
4	7
3	14
2	32
1	46
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9724ddef7/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 01:02:38 2026 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_matched_reads.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Tue Apr 21 01:02:42 2026 ----------------
01:02:42 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_align2genome.bam'
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 178980.64Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.57gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 556923.73Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 540447.38Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.77gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 421436.44Read/s]
-- Running step: isoform_identification @ Tue Apr 21 01:02:43 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 01:02:43 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq, /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Tue Apr 21 01:02:46 2026 ----------
01:02:46 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9724ddef7/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9724ddef7/sample1_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9724ddef7/sample2_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9724ddef7/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
i Writing configuration to: /tmp/RtmpiVZk7q/file1101e9240ec09a/config_file_1114601.json
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Tue Apr 21 01:02:50 2026 ----------------
Using flexiplex for barcode demultiplexing.
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9240ec09a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 993
Number of reads where at least one barcode was found: 929
Number of chimera reads: 2
All done!
Reads	Barcodes
29	1
24	1
22	1
21	2
20	3
19	1
18	2
16	4
15	1
14	1
13	5
11	4
10	7
9	5
8	9
7	3
6	13
5	14
4	2
3	32
2	20
1	6
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9240ec09a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 281
Number of chimera reads: 1
All done!
Reads	Barcodes
9	1
8	3
7	1
6	4
5	5
4	8
3	16
2	33
1	50
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9240ec09a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 300
Number of reads where at least one barcode was found: 280
Number of chimera reads: 0
All done!
Reads	Barcodes
10	1
9	1
7	1
6	4
5	10
4	7
3	16
2	28
1	51
Loading known barcodes from /tmp/RtmpiVZk7q/file1101e9240ec09a/bc_allow.tsv
Number of known barcodes: 143
FLEXIPLEX 1.02.6
Setting max flanking sequence edit distance to 8
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
CB: NNNNNNNNNNNNNNNN
UB: NNNNNNNNNNNN
polyT: TTTTTTTTT
Processing file: /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Tue Apr 21 01:02:51 2026 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_align2genome.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_matched_reads.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_align2genome.bam
-- Running step: gene_quantification @ Tue Apr 21 01:03:13 2026 ----------------
01:03:13 Tue Apr 21 2026 quantify genes 
Using BAM(s): '/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_align2genome.bam',
'/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_align2genome.bam', and
'/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_align2genome.bam'
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 275})
	Counter({'counted_reads': 275, 'not_enough_coverage': 1})
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 10.51gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 173896.08Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.01gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 541675.79Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.63gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 551359.76Read/s]
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 427937.80Read/s]
-- Running step: isoform_identification @ Tue Apr 21 01:03:15 2026 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Tue Apr 21 01:03:15 2026 -------------------
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq, /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample1.fq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample2.fq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_matched_reads.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_realign2transcript.bam
/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Tue Apr 21 01:03:37 2026 ----------
01:03:37 Tue Apr 21 2026 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9240ec09a/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9240ec09a/sample1_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9240ec09a/sample2_realign2transcript.bamdone
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_realign2transcript.bam...
parsing /tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpiVZk7q/file1101e9240ec09a/sample3_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Filtering for genes with at least 2 detected isoforms ...
	6 isoform(s) left.

Aggregating counts by cluster labels ...

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Filtering for genes with at least 2 isoforms expressing more than 1 counts ...
	3 gene(s), 6 transcript(s) left.

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

[ FAIL 0 | WARN 194 | SKIP 0 | PASS 98 ]

[ FAIL 0 | WARN 194 | SKIP 0 | PASS 98 ]
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 275})
	Counter({'counted_reads': 272})
	Counter({'counted_reads': 358})
> 
> proc.time()
   user  system elapsed 
832.224  45.420 864.602

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

name	user	system	elapsed
BulkPipeline	4.017	0.308	4.345
MultiSampleSCPipeline	10.607	0.760	11.598
SingleCellPipeline	2.968	0.123	1.898
add_gene_counts	0.280	0.006	0.286
annotation_to_fasta	0.185	0.001	0.185
barcode_segment	0.001	0.001	0.002
blaze	4.862	16.787	13.008
bulk_long_pipeline	2.375	13.617	2.600
combine_sce	0.733	0.070	0.803
config-set	0.217	0.024	0.240
config	0.211	0.021	0.232
controllers-set	0.363	0.045	0.407
controllers	0.270	0.008	0.279
convolution_filter	0.001	0.000	0.001
create_config	0.021	0.001	0.023
create_sce_from_dir	5.925	2.918	6.747
create_se_from_dir	5.222	0.150	5.357
cutadapt	0.102	0.022	0.124
example_pipeline	0.328	0.009	0.336
experiment	4.874	0.104	4.965
filter_annotation	0.044	0.005	0.049
filter_coverage	1.708	0.052	1.760
find_barcode	1.623	0.249	1.877
find_bin	0.006	0.003	0.009
find_diversity	1.586	0.107	1.849
find_variants	21.645	1.180	21.757
get_coverage	1.805	0.068	1.885
index_genome	0.216	0.012	0.226
mutation_positions	1.563	0.157	1.719
plot_coverage	3.699	0.068	3.767
plot_demultiplex	2.913	0.189	3.103
plot_demultiplex_raw	1.392	0.081	1.486
plot_durations	5.127	0.206	5.317
plot_isoform_heatmap	3.175	0.342	3.517
plot_isoform_reduced_dim	20.877	1.169	22.048
plot_isoforms	1.749	0.021	1.770
resume_FLAMES	4.855	0.116	4.955
run_FLAMES	4.928	0.129	5.042
run_step	2.038	0.046	2.085
sc_DTU_analysis	7.122	1.868	6.981
sc_genotype	5.600	0.381	5.821
sc_impute_transcript	0.679	0.061	0.740
sc_long_multisample_pipeline	8.370	5.905	8.293
sc_long_pipeline	3.220	1.293	2.730
sc_mutations	2.893	0.651	2.948
sc_plot_genotype	11.871	0.920	11.610
show-FLAMESPipeline	0.329	0.018	0.346
steps-set	0.482	0.018	0.500
steps	0.149	0.016	0.166
weight_transcripts	0.027	0.017	0.044