Package: trena

Version: 1.0.3

Command: /home/biocbuild/bbs-3.6-bioc/R/bin/R CMD check --no-vignettes --timings trena_1.0.3.tar.gz

StartedAt: 2018-04-12 03:25:50 -0400 (Thu, 12 Apr 2018)

EndedAt: 2018-04-12 03:38:39 -0400 (Thu, 12 Apr 2018)

EllapsedTime: 768.8 seconds

RetCode: 0

Status:  OK

CheckDir: trena.Rcheck

Warnings: 0

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.6-bioc/R/bin/R CMD check --no-vignettes --timings trena_1.0.3.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck’
* using R version 3.4.4 (2018-03-15)
* using platform: x86_64-pc-linux-gnu (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘trena/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘trena’ version ‘1.0.3’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘trena’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
.elasticNetSolver: no visible binding for global variable
  ‘cor.target.feature’
assessSnp,Trena: no visible binding for global variable ‘status’
assessSnp,Trena: no visible binding for global variable ‘assessed’
assessSnp,Trena: no visible binding for global variable
  ‘motifRelativeScore’
Undefined global functions or variables:
  assessed cor.target.feature motifRelativeScore status
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking installed files from ‘inst/doc’ ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU or elapsed time > 5s
                                              user system elapsed
createGeneModel                              4.476  0.004   5.405
HumanDHSFilter-class                         0.904  0.008   5.097
getEncodeRegulatoryTableNames-HumanDHSFilter 0.764  0.008   5.395
getCandidates-FootprintFilter-method         0.220  0.000   5.648
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 NOTE
See
  ‘/home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/00check.log’
for details.

* installing *source* package ‘trena’ ...
** R
** inst
** preparing package for lazy loading
See system.file("LICENSE", package="MotifDb") for use restrictions.
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
See system.file("LICENSE", package="MotifDb") for use restrictions.
* DONE (trena)

R version 3.4.4 (2018-03-15) -- "Someone to Lean On"
Copyright (C) 2018 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> require(trena) || stop("unable to load trena Package")
Loading required package: trena
Loading required package: glmnet
Loading required package: Matrix
Loading required package: foreach
Loaded glmnet 2.0-16

Loading required package: MotifDb
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:Matrix':

    colMeans, colSums, rowMeans, rowSums, which

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, cbind, colMeans, colSums, colnames, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
    pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
    setdiff, sort, table, tapply, union, unique, unsplit, which,
    which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:Matrix':

    expand

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: Biostrings
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

See system.file("LICENSE", package="MotifDb") for use restrictions.

[1] TRUE
> BiocGenerics:::testPackage('trena')
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_CandidateFilter
[1] --- test_CandidateFilter
[1] --- test_EnsembleSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_selectedSolversOnly
[1] --- test_pcaError
[1] --- test_getSolverNames
[1] --- test_oneSolver
[1] --- test_invalidSolvers
[1] --- test_EnsembleSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_getSolverNames
[1] --- test_invalidSolvers
[1] --- test_oneSolver
[1] --- test_pcaError
[1] --- test_selectedSolversOnly
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
Loading required package: DBI
[1] --- test_parseDatabaseUri
[1] --- test_constructor
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_getChromLoc
[1] --- test_getGenePromoterRegion
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getFootprintsForGene
Warning: call dbDisconnect() when finished working with a connection
[1] --- test_constructor
[1] --- test_getChromLoc
[1] --- test_getFootprintsForGene
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getGenePromoterRegion
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_parseDatabaseUri
[1] --- test_directMode
Loading required package: org.Hs.eg.db
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor

    Vignettes contain introductory material; view with
    'browseVignettes()'. To cite Bioconductor, see
    'citation("Biobase")', and for packages 'citation("pkgname")'.

[1] --- test_directMode
[1] --- test_basicConstructor
[1] --- test_getEncodeRegulatoryTableNames
[1] --- test_checkSampleOfEncodeTables
[1] --- wgEncodeRegDnaseUwAg04449Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHmvecdneoPeak: 0 rows
[1] --- wgEncodeRegDnaseUwTh1Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHsmmtubePeak: 0 rows
[1] --- wgEncodeRegDnaseUwHcpepicPeak: 0 rows
[1] --- wgEncodeRegDnaseUwNhaPeak: 0 rows
[1] --- wgEncodeRegDnaseUwNb4Peak: 0 rows
[1] --- wgEncodeRegDnaseUwHmvecdlyadPeak: 0 rows
[1] --- wgEncodeRegDnaseUwBonemarrowmscPeak: 0 rows
[1] --- wgEncodeRegDnaseUwGm06990Peak: 0 rows
[1] --- test_getRegulatoryRegions
[1] --- test_getCandidates.emptyRegion
[1] --- test_getCandidates.vrk2.twoRegions
[1] --- test_getCandidates.vrk2.rs13384219.variant
[1] --- test_basicConstructor
[1] --- test_checkSampleOfEncodeTables
[1] --- test_getCandidates.emptyRegion
[1] --- test_getCandidates.vrk2.rs13384219.variant
[1] --- test_getCandidates.vrk2.twoRegions
[1] --- test_getEncodeRegulatoryTableNames
[1] --- test_getRegulatoryRegions
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_alpha.lasso
[1] --- test_lambda.lasso
[1] --- test_keep.metrics.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.lasso
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_keep.metrics.lasso
[1] --- test_lambda.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_.getScoredMotifs
[1] --- test_.injectSnp
[1] --- test_.matchPwmForwardAndReverse
[1] --- test_basicConstructor
[1] --- test_bugInStartEndOfMinusStrandHits
[1] --- test_findMatchesByChromosomalRegion
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] --- about to check best$seq
$motifName
[1] "Hsapiens-jaspar2016-POU5F1B-MA0792.1"

$chrom
[1] "chr2"

$motifStart
[1] 57907318

$motifEnd
[1] 57907326

$strand
[1] "+"

$motifScore
[1] 6.707832

$motifRelativeScore
[1] 0.9208761

$match
[1] "CATGCAAAT"

$chromStart
[1] 57907313

$chromEnd
[1] 57907333

$seq
[1] "ACCAGCATGCAAATTAGACAA"

$status
[1] "wt"

[1] --- test_findMatchesByChromosomalRegion.twoAlternateAlleles
[1] --- test_findMatchesByChromosomalRegion_contrastReferenceWithVariant
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCGAATTAGACAA    mut
[1] 1 +
[1] 1 -
[1] 1 +
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCAAATTAGACAA     wt
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] ---- MotifMatcher::findMatchesByChromosomalRegion
  chrom    start      end                   seq status
1  chr2 57907313 57907333 ACCAGCATGCGAATTAGACAA    mut
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] 1 +
[1] 1 -
[1] --- test_findMatchesByMultipleChromosomalRegions
[1] --- test_getSequence
[1] --- test_getSequenceWithVariants
[1] --- test_noMatch
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_RandomForestSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RandomForestSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_alpha.ridge
[1] --- test_lambda.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.ridge
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_lambda.ridge
[1] --- test_getAssayData
Warning in Solver(mtx, "gene1", c("gene2", "gene3")) :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_getTarget
[1] --- test_getRegulators
[1] --- test_eliminateSelfTFs
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_eliminateSelfTFs
[1] --- test_getAssayData
[1] --- test_getRegulators
[1] --- test_getTarget
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_basicConstructor
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_assessSnp
[1] error, unrecognized variant name: 'rsBogus'
[1] --- test_assessSnp_allTypesWithDeltas
[1] --- test_basicConstructor
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.6-bioc/meat/trena.Rcheck/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_VarianceFilter
[1] --- test_VarianceFilter


RUNIT TEST PROTOCOL -- Thu Apr 12 03:38:34 2018 
*********************************************** 
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 

 
1 Test Suite : 
trena RUnit Tests - 85 test functions, 0 errors, 0 failures
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 
Warning messages:
1: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
2: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
3: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
> 
> proc.time()
   user  system elapsed 
369.260  15.844 465.963 

name	user	system	elapsed
BayesSpikeSolver	0.016	0.000	0.016
CandidateFilter-class	0.004	0.000	0.001
EnsembleSolver	0.012	0.000	0.012
FootprintFilter-class	0.600	0.000	4.759
GeneOntologyFilter-class	0.052	0.000	0.053
HumanDHSFilter-class	0.904	0.008	5.097
LassoPVSolver	0.012	0.000	0.012
LassoSolver	0.012	0.000	0.012
MotifMatcher-class	0.076	0.000	0.076
PearsonSolver	0.004	0.008	0.013
RandomForestSolver	0.056	0.000	0.053
RidgeSolver	0.012	0.000	0.012
Solver-class	0.008	0.000	0.010
SpearmanSolver	0.012	0.000	0.011
SqrtLassoSolver	0.012	0.000	0.012
Trena-class	0.000	0.000	0.001
VarianceFilter-class	0.008	0.000	0.006
assessSnp	0	0	0
createGeneModel	4.476	0.004	5.405
findMatchesByChromosomalRegion	0	0	0
getAssayData	0.012	0.000	0.009
getAvailableSolvers	0.000	0.000	0.001
getCandidates-FootprintFilter-method	0.220	0.000	5.648
getCandidates-GeneOntologyFilter-method	0.672	0.032	0.705
getCandidates-HumanDHSFilter-method	0.000	0.000	0.001
getCandidates-VarianceFilter-method	0.008	0.004	0.011
getChromLoc	0.008	0.000	0.009
getEncodeRegulatoryTableNames-HumanDHSFilter	0.764	0.008	5.395
getFootprintsForGene	0.016	0.000	0.016
getFootprintsInRegion	0.012	0.004	0.017
getGeneModelTableColumnNames	0.000	0.000	0.002
getGenePromoterRegion	0.032	0.000	0.032
getGtfGeneBioTypes	0.012	0.000	0.011
getGtfMoleculeTypes	0.008	0.000	0.008
getPfms	0.080	0.000	0.079
getPromoterRegionsAllGenes	0.180	0.008	0.188
getProximalPromoter	0.108	0.012	3.955
getRegulators	0.004	0.004	0.011
getRegulatoryChromosomalRegions	1.100	0.028	2.762
getRegulatoryRegions	0.000	0.000	0.002
getRegulatoryTableColumnNames	0.004	0.000	0.002
getSequence	0.000	0.000	0.001
getSolverNames	0.012	0.000	0.014
getTarget	0.012	0.000	0.013
parseChromLocString	0.012	0.004	0.016
parseDatabaseUri	0.000	0.000	0.002
rescalePredictorWeights	0.012	0.000	0.015
show-HumanDHSFilter-method	0.256	0.016	4.578
show.BayesSpikeSolver	0.020	0.000	0.022
show.EnsembleSolver	0.016	0.000	0.016
show.LassoPVSolver	0.036	0.000	0.038
show.LassoSolver	0.012	0.000	0.014
show.MotifMatcher	0.012	0.000	0.014
show.PearsonSolver	0.02	0.00	0.02
show.RandomForestSolver	0.012	0.000	0.014
show.RidgeSolver	0.012	0.000	0.014
show.SpearmanSolver	0.02	0.00	0.02
show.SqrtLassoSolver	0.020	0.000	0.021
solve.BayesSpike	0.000	0.000	0.001
solve.Ensemble	0.004	0.000	0.002
solve.Lasso	2.972	0.000	2.974
solve.LassoPV	0.168	0.000	0.189
solve.Pearson	0.012	0.000	0.012
solve.RandomForest	3.204	0.008	3.216
solve.Ridge	3.328	0.028	3.357
solve.Spearman	0.020	0.000	0.022
solve.SqrtLasso	0.004	0.000	0.000