| Back to Multiple platform build/check report for BioC 3.23: simplified long |
|
This page was generated on 2025-12-23 11:35 -0500 (Tue, 23 Dec 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | R Under development (unstable) (2025-10-20 r88955) -- "Unsuffered Consequences" | 4878 |
| kjohnson3 | macOS 13.7.7 Ventura | arm64 | R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences" | 4593 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 1756/2332 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| rfaRm 1.23.0 (landing page) Lara Selles Vidal
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | OK | |||||||||
| kjohnson3 | macOS 13.7.7 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
|
To the developers/maintainers of the rfaRm package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: rfaRm |
| Version: 1.23.0 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings rfaRm_1.23.0.tar.gz |
| StartedAt: 2025-12-22 21:50:55 -0500 (Mon, 22 Dec 2025) |
| EndedAt: 2025-12-22 21:52:24 -0500 (Mon, 22 Dec 2025) |
| EllapsedTime: 89.3 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: rfaRm.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings rfaRm_1.23.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/rfaRm.Rcheck’
* using R Under development (unstable) (2025-11-04 r88984)
* using platform: aarch64-apple-darwin20
* R was compiled by
Apple clang version 16.0.0 (clang-1600.0.26.6)
GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.8
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘rfaRm/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘rfaRm’ version ‘1.23.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘rfaRm’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for ‘as’
Undefined global functions or variables:
as
Consider adding
importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘rfaRm-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
>
> ### ** Examples
>
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
>
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { :
argument is of length zero
Calls: rfamSequenceSearch
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘runTests.R’
ERROR
Running the tests in ‘tests/runTests.R’ failed.
Last 13 lines of output:
1 Test Suite :
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { :
argument is of length zero
Test files with failing tests
test_searchFunctions.R
/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R
Error in BiocGenerics:::testPackage("rfaRm") :
unit tests failed for package rfaRm
Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 2 ERRORs, 1 NOTE
See
‘/Users/biocbuild/bbs-3.23-bioc/meat/rfaRm.Rcheck/00check.log’
for details.
rfaRm.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL rfaRm ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library’ * installing *source* package ‘rfaRm’ ... ** this is package ‘rfaRm’ version ‘1.23.0’ ** using staged installation ** R ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (rfaRm)
rfaRm.Rcheck/tests/runTests.Rout.fail
R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.61.0
2025-12-22 21:52:03.787 R[94716:495204241] XType: Using static font registry.
format width height colorspace matte filesize density
1 SVG 700 550 sRGB TRUE 18144 96x96
format width height colorspace matte filesize density
1 GIF 600 2084 sRGB FALSE 75288 72x72
Column 9 ['bit_score'] of item 2 appears in position 1 in item 1. Set use.names=TRUE to match by column name, or use.names=FALSE to ignore column names. use.names='check' (default from v1.12.2) emits this message and proceeds as if use.names=FALSE for backwards compatibility. See news item 5 in v1.12.2 for options to control this message.
Column 9 ['bit_score'] of item 2 appears in position 1 in item 1. Set use.names=TRUE to match by column name, or use.names=FALSE to ignore column names. use.names='check' (default from v1.12.2) emits this message and proceeds as if use.names=FALSE for backwards compatibility. See news item 5 in v1.12.2 for options to control this message.
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { :
argument is of length zero
RUNIT TEST PROTOCOL -- Mon Dec 22 21:52:20 2025
***********************************************
Number of test functions: 1
Number of errors: 1
Number of failures: 0
1 Test Suite :
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { :
argument is of length zero
Test files with failing tests
test_searchFunctions.R
/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R
Error in BiocGenerics:::testPackage("rfaRm") :
unit tests failed for package rfaRm
Execution halted
rfaRm.Rcheck/rfaRm-Ex.timings
| name | user | system | elapsed | |
| rfamConsensusSecondaryStructure | 0.087 | 0.013 | 3.223 | |
| rfamCovarianceModel | 0.039 | 0.004 | 0.743 | |
| rfamFamilyAccessionToID | 0.004 | 0.000 | 0.095 | |
| rfamFamilyIDToAccession | 0.002 | 0.001 | 0.093 | |
| rfamFamilySummary | 0.020 | 0.001 | 0.553 | |
| rfamPDBMapping | 0.022 | 0.002 | 0.403 | |
| rfamSecondaryStructurePlot | 0.076 | 0.008 | 0.513 | |
| rfamSecondaryStructureXMLSVG | 0.017 | 0.002 | 0.439 | |
| rfamSeedAlignment | 0.139 | 0.013 | 1.230 | |
| rfamSeedTree | 0.020 | 0.002 | 0.415 | |
| rfamSeedTreeImage | 0.025 | 0.003 | 0.469 | |
| rfamSequenceRegions | 0.056 | 0.011 | 1.676 | |