Back to Multiple platform build/check report for BioC 3.23:   simplified   long
ABCDEFGHIJKLMNOPQ[R]STUVWXYZ

This page was generated on 2025-12-23 11:35 -0500 (Tue, 23 Dec 2025).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.3 LTS)x86_64R Under development (unstable) (2025-10-20 r88955) -- "Unsuffered Consequences" 4878
kjohnson3macOS 13.7.7 Venturaarm64R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences" 4593
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 1756/2332HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
rfaRm 1.23.0  (landing page)
Lara Selles Vidal
Snapshot Date: 2025-12-22 13:40 -0500 (Mon, 22 Dec 2025)
git_url: https://git.bioconductor.org/packages/rfaRm
git_branch: devel
git_last_commit: d6208ab
git_last_commit_date: 2025-10-29 10:58:41 -0500 (Wed, 29 Oct 2025)
nebbiolo1Linux (Ubuntu 24.04.3 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
kjohnson3macOS 13.7.7 Ventura / arm64  OK    OK    ERROR    OK  


CHECK results for rfaRm on kjohnson3

To the developers/maintainers of the rfaRm package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: rfaRm
Version: 1.23.0
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings rfaRm_1.23.0.tar.gz
StartedAt: 2025-12-22 21:50:55 -0500 (Mon, 22 Dec 2025)
EndedAt: 2025-12-22 21:52:24 -0500 (Mon, 22 Dec 2025)
EllapsedTime: 89.3 seconds
RetCode: 1
Status:   ERROR  
CheckDir: rfaRm.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings rfaRm_1.23.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/rfaRm.Rcheck’
* using R Under development (unstable) (2025-11-04 r88984)
* using platform: aarch64-apple-darwin20
* R was compiled by
    Apple clang version 16.0.0 (clang-1600.0.26.6)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.8
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘rfaRm/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘rfaRm’ version ‘1.23.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘rfaRm’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for ‘as’
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘rfaRm-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { : 
  argument is of length zero
Calls: rfamSequenceSearch
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 ERROR
Running the tests in ‘tests/runTests.R’ failed.
Last 13 lines of output:
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { : 
    argument is of length zero
  
  Test files with failing tests
  
     test_searchFunctions.R 
       /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 NOTE
See
  ‘/Users/biocbuild/bbs-3.23-bioc/meat/rfaRm.Rcheck/00check.log’
for details.


Installation output

rfaRm.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL rfaRm
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library’
* installing *source* package ‘rfaRm’ ...
** this is package ‘rfaRm’ version ‘1.23.0’
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (rfaRm)

Tests output

rfaRm.Rcheck/tests/runTests.Rout.fail


R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.61.0
2025-12-22 21:52:03.787 R[94716:495204241] XType: Using static font registry.
  format width height colorspace matte filesize density
1    SVG   700    550       sRGB  TRUE    18144   96x96
  format width height colorspace matte filesize density
1    GIF   600   2084       sRGB FALSE    75288   72x72
Column 9 ['bit_score'] of item 2 appears in position 1 in item 1. Set use.names=TRUE to match by column name, or use.names=FALSE to ignore column names. use.names='check' (default from v1.12.2) emits this message and proceeds as if use.names=FALSE for  backwards compatibility. See news item 5 in v1.12.2 for options to control this message.
Column 9 ['bit_score'] of item 2 appears in position 1 in item 1. Set use.names=TRUE to match by column name, or use.names=FALSE to ignore column names. use.names='check' (default from v1.12.2) emits this message and proceeds as if use.names=FALSE for  backwards compatibility. See news item 5 in v1.12.2 for options to control this message.
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { : 
  argument is of length zero


RUNIT TEST PROTOCOL -- Mon Dec 22 21:52:20 2025 
*********************************************** 
Number of test functions: 1 
Number of errors: 1 
Number of failures: 0 

 
1 Test Suite : 
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { : 
  argument is of length zero

Test files with failing tests

   test_searchFunctions.R 
     /private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/Rtmpn7N4jr/RLIBS_13b261d84b64e/rfaRm/unitTests/test_searchFunctions.R 


Error in BiocGenerics:::testPackage("rfaRm") : 
  unit tests failed for package rfaRm
Execution halted

Example timings

rfaRm.Rcheck/rfaRm-Ex.timings

nameusersystemelapsed
rfamConsensusSecondaryStructure0.0870.0133.223
rfamCovarianceModel0.0390.0040.743
rfamFamilyAccessionToID0.0040.0000.095
rfamFamilyIDToAccession0.0020.0010.093
rfamFamilySummary0.0200.0010.553
rfamPDBMapping0.0220.0020.403
rfamSecondaryStructurePlot0.0760.0080.513
rfamSecondaryStructureXMLSVG0.0170.0020.439
rfamSeedAlignment0.1390.0131.230
rfamSeedTree0.0200.0020.415
rfamSeedTreeImage0.0250.0030.469
rfamSequenceRegions0.0560.0111.676