Back to Multiple platform build/check report for BioC 3.23:   simplified   long
[A]BCDEFGHIJKLMNOPQRSTUVWXYZ

This page was generated on 2026-05-05 11:36 -0400 (Tue, 05 May 2026).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.4 LTS)x86_644.6.0 RC (2026-04-17 r89917) -- "Because it was There" 4989
kjohnson3macOS 13.7.7 Venturaarm644.6.0 Patched (2026-04-24 r89963) -- "Because it was There" 4719
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 120/2418HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
atSNP 1.28.0  (landing page)
Sunyoung Shin
Snapshot Date: 2026-05-04 13:40 -0400 (Mon, 04 May 2026)
git_url: https://git.bioconductor.org/packages/atSNP
git_branch: RELEASE_3_23
git_last_commit: 3cbbeaf
git_last_commit_date: 2026-04-28 08:49:34 -0400 (Tue, 28 Apr 2026)
nebbiolo1Linux (Ubuntu 24.04.4 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
kjohnson3macOS 13.7.7 Ventura / arm64  OK    OK    OK    OK  UNNEEDED, same version is already published
See other builds for atSNP in R Universe.


CHECK results for atSNP on nebbiolo1

To the developers/maintainers of the atSNP package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/atSNP.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: atSNP
Version: 1.28.0
Command: /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:atSNP.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings atSNP_1.28.0.tar.gz
StartedAt: 2026-05-04 21:31:51 -0400 (Mon, 04 May 2026)
EndedAt: 2026-05-04 21:37:56 -0400 (Mon, 04 May 2026)
EllapsedTime: 364.4 seconds
RetCode: 0
Status:   OK  
CheckDir: atSNP.Rcheck
Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:atSNP.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings atSNP_1.28.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.23-bioc/meat/atSNP.Rcheck’
* using R version 4.6.0 RC (2026-04-17 r89917)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
* running under: Ubuntu 24.04.4 LTS
* using session charset: UTF-8
* current time: 2026-05-05 01:31:52 UTC
* checking for file ‘atSNP/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘atSNP’ version ‘1.28.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘atSNP’ can be installed ... OK
* used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespaces in Imports field not imported from:
  ‘graphics’ ‘testthat’
  All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
ComputePValues: no visible binding for global variable ‘motif’
ComputePValues: no visible binding for global variable ‘snpid’
ComputePValues: no visible binding for global variable ‘snpbase’
ComputePValues: no visible binding for global variable ‘pval_ref’
ComputePValues: no visible binding for global variable ‘pval_snp’
ComputePValues: no visible binding for global variable ‘pval_cond_ref’
ComputePValues: no visible binding for global variable ‘pval_cond_snp’
ComputePValues: no visible binding for global variable ‘pval_diff’
ComputePValues: no visible binding for global variable ‘pval_rank’
LoadSNPData: no visible global function definition for ‘is’
LoadSNPData: no visible binding for global variable ‘IUPAC_CODE_MAP’
MatchSubsequence: no visible binding for global variable ‘motif’
MatchSubsequence: no visible binding for global variable ‘snpid’
MatchSubsequence: no visible binding for global variable ‘snpbase’
MatchSubsequence: no visible binding for global variable ‘len_seq’
MatchSubsequence: no visible binding for global variable ‘ref_seq’
MatchSubsequence : <anonymous>: no visible binding for global variable
  ‘motif’
checkMotifs: no visible global function definition for ‘is’
checkSNPids: no visible global function definition for ‘is’
dtMotifMatch: no visible binding for global variable ‘ref_seq’
dtMotifMatch: no visible binding for global variable ‘len_seq’
dtMotifMatch: no visible binding for global variable ‘snp_ref_start’
dtMotifMatch: no visible binding for global variable ‘ref_start’
dtMotifMatch: no visible binding for global variable ‘snp_start’
dtMotifMatch: no visible binding for global variable ‘snp_ref_end’
dtMotifMatch: no visible binding for global variable ‘ref_end’
dtMotifMatch: no visible binding for global variable ‘snp_end’
dtMotifMatch: no visible binding for global variable ‘snp_ref_length’
dtMotifMatch: no visible binding for global variable
  ‘ref_aug_match_seq_forward’
dtMotifMatch: no visible binding for global variable
  ‘ref_aug_match_seq_reverse’
dtMotifMatch: no visible binding for global variable
  ‘snp_aug_match_seq_forward’
dtMotifMatch: no visible binding for global variable ‘snp_seq’
dtMotifMatch: no visible binding for global variable
  ‘snp_aug_match_seq_reverse’
dtMotifMatch: no visible binding for global variable ‘ref_strand’
dtMotifMatch: no visible binding for global variable ‘ref_location’
dtMotifMatch: no visible binding for global variable ‘snp_strand’
dtMotifMatch: no visible binding for global variable ‘snp_location’
dtMotifMatch: no visible binding for global variable
  ‘ref_extra_pwm_left’
dtMotifMatch: no visible binding for global variable
  ‘ref_extra_pwm_right’
dtMotifMatch: no visible binding for global variable
  ‘snp_extra_pwm_left’
dtMotifMatch: no visible binding for global variable
  ‘snp_extra_pwm_right’
dtMotifMatch: no visible binding for global variable ‘snpid’
match_subseq_par: no visible binding for global variable ‘snpid’
match_subseq_par: no visible binding for global variable ‘motif’
match_subseq_par: no visible binding for global variable ‘snpbase’
match_subseq_par: no visible binding for global variable ‘ref_strand’
match_subseq_par: no visible binding for global variable
  ‘ref_match_seq’
match_subseq_par: no visible binding for global variable ‘ref_seq’
match_subseq_par: no visible binding for global variable ‘ref_start’
match_subseq_par: no visible binding for global variable ‘ref_end’
match_subseq_par: no visible binding for global variable ‘ref_seq_rev’
match_subseq_par: no visible binding for global variable ‘len_seq’
match_subseq_par: no visible binding for global variable ‘snp_strand’
match_subseq_par: no visible binding for global variable
  ‘snp_match_seq’
match_subseq_par: no visible binding for global variable ‘snp_seq’
match_subseq_par: no visible binding for global variable ‘snp_start’
match_subseq_par: no visible binding for global variable ‘snp_end’
match_subseq_par: no visible binding for global variable ‘snp_seq_rev’
match_subseq_par: no visible binding for global variable
  ‘snp_seq_ref_match’
match_subseq_par: no visible binding for global variable
  ‘ref_seq_snp_match’
match_subseq_par: no visible binding for global variable ‘motif_len’
match_subseq_par: no visible binding for global variable ‘log_lik_ref’
match_subseq_par: no visible binding for global variable ‘log_lik_snp’
match_subseq_par: no visible binding for global variable
  ‘log_lik_ratio’
match_subseq_par: no visible binding for global variable
  ‘log_enhance_odds’
match_subseq_par: no visible binding for global variable
  ‘log_reduce_odds’
match_subseq_par: no visible binding for global variable ‘IUPAC’
motif_score_par: no visible binding for global variable ‘motif’
motif_score_par: no visible binding for global variable ‘snpbase’
plotMotifMatch: no visible global function definition for ‘is’
results_motif_par: no visible binding for global variable ‘p.value’
Undefined global functions or variables:
  IUPAC IUPAC_CODE_MAP is len_seq log_enhance_odds log_lik_ratio
  log_lik_ref log_lik_snp log_reduce_odds motif motif_len p.value
  pval_cond_ref pval_cond_snp pval_diff pval_rank pval_ref pval_snp
  ref_aug_match_seq_forward ref_aug_match_seq_reverse ref_end
  ref_extra_pwm_left ref_extra_pwm_right ref_location ref_match_seq
  ref_seq ref_seq_rev ref_seq_snp_match ref_start ref_strand
  snp_aug_match_seq_forward snp_aug_match_seq_reverse snp_end
  snp_extra_pwm_left snp_extra_pwm_right snp_location snp_match_seq
  snp_ref_end snp_ref_length snp_ref_start snp_seq snp_seq_ref_match
  snp_seq_rev snp_start snp_strand snpbase snpid
Consider adding
  importFrom("methods", "is")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.23-bioc/R/site-library/atSNP/libs/atSNP.so’:
  Found ‘__printf_chk’, possibly from ‘printf’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                user system elapsed
plotMotifMatch 8.541  1.613  10.308
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘test.R’
  Running ‘test_change.R’
  Running ‘test_diff.R’
  Running ‘test_is.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 3 NOTEs
See
  ‘/home/biocbuild/bbs-3.23-bioc/meat/atSNP.Rcheck/00check.log’
for details.


Installation output

atSNP.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD INSTALL atSNP
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.23-bioc/R/site-library’
* installing *source* package ‘atSNP’ ...
** this is package ‘atSNP’ version ‘1.28.0’
** using staged installation
** libs
using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0’
g++ -std=gnu++20 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG  -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c ImportanceSample.cpp -o ImportanceSample.o
g++ -std=gnu++20 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG  -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c ImportanceSampleChange.cpp -o ImportanceSampleChange.o
g++ -std=gnu++20 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG  -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c ImportanceSampleDiff.cpp -o ImportanceSampleDiff.o
g++ -std=gnu++20 -I"/home/biocbuild/bbs-3.23-bioc/R/include" -DNDEBUG  -I'/home/biocbuild/bbs-3.23-bioc/R/site-library/Rcpp/include' -I/usr/local/include    -fpic  -g -O2  -Wall -Werror=format-security  -c MotifScore.cpp -o MotifScore.o
g++ -std=gnu++20 -shared -L/home/biocbuild/bbs-3.23-bioc/R/lib -L/usr/local/lib -o atSNP.so ImportanceSample.o ImportanceSampleChange.o ImportanceSampleDiff.o MotifScore.o -L/home/biocbuild/bbs-3.23-bioc/R/lib -lR
installing to /home/biocbuild/bbs-3.23-bioc/R/site-library/00LOCK-atSNP/00new/atSNP/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (atSNP)

Tests output

atSNP.Rcheck/tests/test.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(atSNP)
> library(BiocParallel)
> library(testthat)
> 
> ## process the data
> data(example)
> 
> motif_scores <- ComputeMotifScore(motif_library, snpInfo, ncores = 1)
> 
> motif_scores <- MatchSubsequence(motif_scores$snp.tbl, motif_scores$motif.scores, ncores = 1, motif.lib = motif_library)
> 
> motif_scores[which(motif_scores$snpid == "rs7412" & motif_scores$motif == "SIX5_disc1"), ]
   snpid      motif
4 rs7412 SIX5_disc1
                                                        ref_seq
4 CTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCG
                                                        snp_seq motif_len
4 CTCCTCCGCGATGCCGATGACCTGCAGAAGTGCCTGGCAGTGTACCAGGCCGGGGCCCGCG        10
  ref_start ref_end ref_strand snp_start snp_end snp_strand log_lik_ref
4        29      38          -        22      31          +   -42.60672
  log_lik_snp log_lik_ratio log_enhance_odds log_reduce_odds      IUPAC
4    -38.4083     -4.198418           23.013       -2.917768 GARWTGTAGT
  ref_match_seq snp_match_seq ref_seq_snp_match snp_seq_ref_match snpbase
4    GCCAGGCGCT    CTGCAGAAGT        CTGCAGAAGC        GCCAGGCACT       T
> 
> len_seq <- sapply(motif_scores$ref_seq, nchar)
> snp_pos <- as.integer(len_seq / 2) + 1
> 
> i <- which(motif_scores$snpid == "rs7412" & motif_scores$motif == "SIX5_disc1")
> 
> test_that("Error: reference bases are not the same as the sequence matrix.", {
+   expect_equal(sum(snpInfo$sequence_matrix[31, ] != snpInfo$ref_base), 0)
+   expect_equal(sum(snpInfo$sequence_matrix[31, ] == snpInfo$snp_base), 0)
+ })
Test passed with 2 successes 🎊.
> 
> test_that("Error: log_lik_ratio is not correct.", {
+   expect_equal(motif_scores$log_lik_ref - motif_scores$log_lik_snp, motif_scores$log_lik_ratio)
+ })
Test passed with 1 success 🥇.
> 
> test_that("Error: log likelihoods are not correct.", {
+ 
+   log_lik <- sapply(seq(nrow(motif_scores)),
+                         function(i) {
+                           motif_mat <- motif_library[[motif_scores$motif[i]]]
+                           colind<-which(snpInfo$snpids==motif_scores$snpid[i]) 
+                           bases <- snpInfo$sequence_matrix[motif_scores$ref_start[i]:motif_scores$ref_end[i], colind]
+                           if(motif_scores$ref_strand[i] == "-")
+                             bases <- 5 - rev(bases)
+                           log(prod(
+                                    motif_mat[cbind(seq(nrow(motif_mat)),
+                                                    bases)]))
+                         })
+ 
+   expect_equal(log_lik, motif_scores$log_lik_ref)
+ 
+   snp_mat <- snpInfo$sequence_matrix
+   snp_mat[cbind(snp_pos, seq(ncol(snp_mat)))] <- snpInfo$snp_base
+   log_lik <- sapply(seq(nrow(motif_scores)),
+                     function(i) {
+                       motif_mat <- motif_library[[motif_scores$motif[i]]]
+                       colind<-which(snpInfo$snpids==motif_scores$snpid[i])
+                       bases <- snp_mat[motif_scores$snp_start[i]:motif_scores$snp_end[i], colind]
+                       if(motif_scores$snp_strand[i] == "-")
+                         bases <- 5 - rev(bases)
+                       log(prod(
+                                motif_mat[cbind(seq(nrow(motif_mat)),
+                                                bases)]))
+                     })
+ 
+   expect_equal(log_lik, motif_scores$log_lik_snp)
+ })
Test passed with 2 successes 🌈.
> 
> test_that("Error: log_enhance_odds not correct.", {
+   
+   len_seq <- sapply(motif_scores$ref_seq, nchar)
+   snp_pos <- as.integer(len_seq / 2) + 1
+ 
+   ## log odds for reduction in binding affinity
+   
+   pos_in_pwm <- snp_pos - motif_scores$ref_start + 1
+   neg_ids <- which(motif_scores$ref_strand == "-")
+   pos_in_pwm[neg_ids] <- motif_scores$ref_end[neg_ids]- snp_pos[neg_ids] + 1
+   snp_base <- sapply(substr(motif_scores$snp_seq, snp_pos, snp_pos), function(x) which(c("A", "C", "G", "T") == x))
+   ref_base <- sapply(substr(motif_scores$ref_seq, snp_pos, snp_pos), function(x) which(c("A", "C", "G", "T") == x))
+   snp_base[neg_ids] <- 5 - snp_base[neg_ids]
+   ref_base[neg_ids] <- 5 - ref_base[neg_ids]
+   my_log_reduce_odds <- sapply(seq(nrow(motif_scores)),
+                                function(i)
+                                log(motif_library[[motif_scores$motif[i]]][pos_in_pwm[i], ref_base[i]]) -
+                                log(motif_library[[motif_scores$motif[i]]][pos_in_pwm[i], snp_base[i]])
+                                )
+ 
+   expect_equal(my_log_reduce_odds, motif_scores$log_reduce_odds)
+ 
+   ## log odds in enhancing binding affinity
+   
+   pos_in_pwm <- snp_pos - motif_scores$snp_start + 1
+   neg_ids <- which(motif_scores$snp_strand == "-")
+   pos_in_pwm[neg_ids] <- motif_scores$snp_end[neg_ids]- snp_pos[neg_ids] + 1
+   snp_base <- sapply(substr(motif_scores$snp_seq, snp_pos, snp_pos), function(x) which(c("A", "C", "G", "T") == x))
+   ref_base <- sapply(substr(motif_scores$ref_seq, snp_pos, snp_pos), function(x) which(c("A", "C", "G", "T") == x))
+   snp_base[neg_ids] <- 5 - snp_base[neg_ids]
+   ref_base[neg_ids] <- 5 - ref_base[neg_ids]
+   my_log_enhance_odds <- sapply(seq(nrow(motif_scores)),
+                                 function(i)
+                                 log(motif_library[[motif_scores$motif[i]]][pos_in_pwm[i], snp_base[i]]) -
+                                 log(motif_library[[motif_scores$motif[i]]][pos_in_pwm[i], ref_base[i]]) 
+                                )
+ 
+   expect_equal(my_log_enhance_odds, motif_scores$log_enhance_odds)
+   
+ 
+ })
Test passed with 2 successes 🥳.
> 
> test_that("Error: the maximum log likelihood computation is not correct.", {
+ 
+   snp_mat <- snpInfo$sequence_matrix
+   snp_mat[cbind(snp_pos, seq(ncol(snp_mat)))] <- snpInfo$snp_base
+ 
+   .findMaxLog <- function(seq_vec, pwm) {
+     snp_pos <- as.integer(length(seq_vec) / 2) + 1
+     start_pos <- snp_pos - nrow(pwm) + 1
+     end_pos <- snp_pos
+     rev_seq <- 5 - rev(seq_vec)
+     
+     maxLogProb <- -Inf
+     for(i in start_pos : end_pos) {
+       LogProb <- log(prod(pwm[cbind(seq(nrow(pwm)),
+                                     seq_vec[i - 1 + seq(nrow(pwm))])]))
+       if(LogProb > maxLogProb)
+         maxLogProb <- LogProb
+     }
+     for(i in start_pos : end_pos) {
+       LogProb <- log(prod(pwm[cbind(seq(nrow(pwm)),
+                                     rev_seq[i - 1 + seq(nrow(pwm))])]))
+       if(LogProb > maxLogProb)
+         maxLogProb <- LogProb
+     }
+     return(maxLogProb)
+   }
+   
+   ## find the maximum log likelihood on the reference sequence
+   my_log_lik_ref <- sapply(seq(nrow(motif_scores)),
+                            function(x) {
+ 		                         colind<-which(snpInfo$snpids==motif_scores$snpid[x])                           	
+                              seq_vec<- snpInfo$sequence_matrix[, colind]
+                              pwm <- motif_library[[motif_scores$motif[x]]]
+                              return(.findMaxLog(seq_vec, pwm))
+                            })
+ 
+   ## find the maximum log likelihood on the SNP sequence
+ 
+   my_log_lik_snp <- sapply(seq(nrow(motif_scores)),
+                            function(x) {
+                       		  colind<-which(snpInfo$snpids==motif_scores$snpid[x]) #ADDED
+                             seq_vec<- snp_mat[, colind]
+                             pwm <- motif_library[[motif_scores$motif[x]]]
+                             return(.findMaxLog(seq_vec, pwm))
+                            })
+   
+   expect_equal(my_log_lik_ref, motif_scores$log_lik_ref)
+   expect_equal(my_log_lik_snp, motif_scores$log_lik_snp)
+   
+ })
Test passed with 2 successes 🎊.
> 
> proc.time()
   user  system elapsed 
 13.708   0.589  14.288 

atSNP.Rcheck/tests/test_change.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(atSNP)
> library(BiocParallel)
> library(testthat)
> data(example)
> 
> trans_mat <- matrix(rep(snpInfo$prior, each = 4), nrow = 4)
> test_pwm <- motif_library$SIX5_disc1
> scores <- as.matrix(motif_scores$motif.scores[3:4, 4:5])
> score_diff <- abs(scores[,2]-scores[,1])
> 
> pval_a <- .Call("test_p_value", test_pwm, snpInfo$prior, snpInfo$transition, scores, 0.15, 100)
> pval_ratio <- abs(log(pval_a[seq(nrow(scores)),1]) - log(pval_a[seq(nrow(scores)) + nrow(scores), 1]))
> 
> test_score <- test_pwm
> for(i in seq(nrow(test_score))) {
+   for(j in seq(ncol(test_score))) {
+     test_score[i, j] <- exp(mean(log(test_pwm[i, j] / test_pwm[i, -j])))
+   }
+ }
> 
> adj_mat <- test_pwm + 0.25
> motif_len <- nrow(test_pwm)
> 
> ## these are functions for this test only
> drawonesample <- function(theta) {
+     prob_start <- rev(rowSums(test_score ^ theta) / rowSums(adj_mat))
+     id <- sample(seq(motif_len), 1, prob = prob_start)
+     sample <- sample(1:4, 2 * motif_len - 1, replace = TRUE, prob = snpInfo$prior)
+     delta <- adj_mat
+     delta[motif_len - id + 1, ] <- test_score[motif_len - id + 1, ] ^ theta
+     sample[id - 1 + seq(motif_len)] <- apply(delta, 1, function(x) sample(seq(4), 1, prob = x))
+     ## compute weight
+     sc <- 0
+     for(s in seq(motif_len)) {
+       delta <- adj_mat
+       delta[motif_len + 1 - s, ] <- test_score[motif_len + 1 - s, ] ^ theta
+       sc <- sc + prod(delta[cbind(seq(motif_len), sample[s - 1 + seq(motif_len)])]) /
+         prod(snpInfo$prior[sample[s - 1 + seq(motif_len)]])
+     }
+     sample <- c(sample, id, sc)
+     return(sample)
+ }
> jointprob <- function(x) prod(test_pwm[cbind(seq(motif_len), x)])
> maxjointprob <- function(x) {
+   maxp <- -Inf
+   p <- -Inf
+   for(i in 1:motif_len) {
+     p <- jointprob(x[i:(i+motif_len - 1)])
+     if(p > maxp)
+       maxp <- p
+   }
+   for(i in 1:motif_len) {
+     p <- jointprob(5 - x[(i+motif_len - 1):i])
+     if(p > maxp)
+       maxp <- p
+   }
+   return(maxp)
+ }
> get_freq <- function(sample) {
+   emp_freq <- matrix(0, nrow = 2 * motif_len - 1, ncol = 4)
+   for(i in seq(2 * motif_len - 1)) {
+     for(j in seq(4)) {
+       emp_freq[i, j] <- sum(sample[i, ] == j - 1)
+     }
+   }
+   emp_freq <- emp_freq / rowSums(emp_freq)
+   return(emp_freq)
+ }
> 
> test_that("Error: quantile function computing are not equivalent.", {
+   for(p in c(0.01, 0.1, 0.5, 0.9, 0.99) ) {
+     delta <- .Call("test_find_percentile_change", score_diff, p, package = "atSNP")
+     delta.r <- as.double(sort(abs(scores[,2]-scores[,1]))[ceiling((1 - p) * (nrow(scores)))])
+     expect_equal(delta, delta.r)
+   }
+ })
Test passed with 5 successes 🎊.
> 
> test_that("Error: the scores for samples are not equivalent.", {
+   p <- 0.1
+   delta <- .Call("test_find_percentile_change", score_diff, p, package = "atSNP")
+   theta <- .Call("test_find_theta_change", test_score, adj_mat, delta, package = "atSNP")
+   ## Use R code to generate a random sample
+   for(i in seq(10)) {
+     sample <- drawonesample(theta)
+     sample_score <- .Call("test_compute_sample_score_change", test_pwm, test_score, adj_mat, sample[seq(2 * motif_len - 1)] - 1, snpInfo$prior, trans_mat, sample[2 * motif_len] - 1, theta, package = "atSNP")
+     expect_equal(sample[2 * motif_len + 1], sample_score[1])
+     sample1 <- sample2 <- sample3 <- sample
+     sample1[motif_len] <- seq(4)[-sample[motif_len]][1]
+     sample2[motif_len] <- seq(4)[-sample[motif_len]][2]
+     sample3[motif_len] <- seq(4)[-sample[motif_len]][3]
+     sample_score_r <- log(maxjointprob(sample[seq(2 * motif_len - 1)])) -
+       log(c(maxjointprob(sample1[seq(2 * motif_len - 1)]),
+             maxjointprob(sample2[seq(2 * motif_len - 1)]),
+             maxjointprob(sample3[seq(2 * motif_len - 1)])))
+     expect_equal(sample_score_r, sample_score[2:4])
+   }
+   
+   ## Use C code to generate a random sample
+   for(i in seq(10)) {
+     sample <- .Call("test_importance_sample_change", test_score, snpInfo$prior, trans_mat, test_pwm, theta, package = "atSNP")
+     start_pos <- sample[2 * motif_len] + 1
+     adj_score <- 0
+     for(s in seq_len(motif_len)) {
+       adj_s <- sum(log(adj_mat[cbind(seq(motif_len), sample[s - 1 + seq(motif_len)] + 1)]) -
+                    log(snpInfo$prior[sample[s - 1 + seq(motif_len)] + 1]))
+       adj_s <- adj_s + theta * log(test_score[motif_len + 1 - s, sample[motif_len] + 1]) -
+           log(adj_mat[motif_len + 1 - s, sample[motif_len] + 1])
+       adj_score <- adj_score + exp(adj_s)
+     }
+     sample_score <- .Call("test_compute_sample_score_change", test_pwm, test_score, adj_mat, sample[seq(2 * motif_len - 1)], snpInfo$prior, trans_mat, sample[2 * motif_len], theta, package = "atSNP")
+     expect_equal(adj_score, sample_score[1])
+   }
+ })
Test passed with 30 successes 🌈.
> 
> test_that("Error: compute the normalizing constant.", {
+   ## parameters
+   for(p in seq(9) / 10) {
+     delta <- .Call("test_find_percentile_change", score_diff, p, package = "atSNP")
+     theta <- .Call("test_find_theta_change", test_score, adj_mat, delta, package = "atSNP")
+     const <- .Call("test_func_delta_change", test_score, adj_mat, theta, package = "atSNP")
+     ## in R
+     adj_sum <- rowSums(adj_mat)
+     wei_sum <- rowSums(test_score ^ theta)
+     const.r <- prod(adj_sum) * sum(wei_sum / adj_sum)
+     expect_equal(const, const.r)
+   }
+ })
Test passed with 9 successes 🌈.
> 
> test_that("Error: sample distributions are not expected.", {
+   ## parameters
+   p <- 0.1
+   delta <- .Call("test_find_percentile_change", score_diff, p, package = "atSNP")
+   theta <- .Call("test_find_theta_change", test_score, adj_mat, delta, package = "atSNP")
+   prob_start <- rev(rowSums(test_score ^ theta) / rowSums(adj_mat))
+   ## construct the delta matrix
+   delta <- matrix(1, nrow = 4 * motif_len, ncol = 2 * motif_len - 1)
+   for(pos in seq(motif_len)) {
+     delta[seq(4) + 4 * (pos - 1), ] <- snpInfo$prior
+     delta[seq(4) + 4 * (pos - 1), pos - 1 + seq(motif_len)] <- t(test_pwm)
+     delta[seq(4) + 4 * (pos - 1), motif_len] <- test_score[motif_len + 1 - pos, ] ^ theta
+     delta[seq(4) + 4 * (pos - 1), ] <- delta[seq(4) + 4 * (pos - 1),] / rep(colSums(delta[seq(4) + 4 * (pos - 1), ]), each = 4)
+   }
+   target_freq <- matrix(0, nrow = 4, ncol = 2 * motif_len - 1)
+   for(pos in seq(motif_len)) {
+     target_freq <- target_freq + delta[seq(4) + 4 * (pos - 1), ] * prob_start[pos]
+   }
+   target_freq <- t(target_freq)
+   target_freq <- target_freq / rowSums(target_freq)
+ 
+   results_i <- function(i) {
+     ## generate 100 samples
+     sample1 <- sapply(seq(100), function(x)
+       .Call("test_importance_sample_change",
+             adj_mat, snpInfo$prior, trans_mat, test_score, theta, package = "atSNP"))
+     emp_freq1 <- get_freq(sample1)
+     sample2 <- sapply(rep(theta, 100), drawonesample)
+     emp_freq2 <- get_freq(sample2 - 1)
+     ##    print(rbind(emp_freq1[10, ], emp_freq2[10, ], target_freq[10, ]))
+     max(abs(emp_freq1 - target_freq)) > max(abs(emp_freq2 - target_freq))
+   }
+   
+   if(Sys.info()[["sysname"]] == "Windows"){
+     snow <- SnowParam(workers = 1, type = "SOCK")
+     results<-bpmapply(results_i, seq(20), BPPARAM = snow,SIMPLIFY = FALSE)
+   }else{
+     results<-bpmapply(results_i, seq(20), BPPARAM = MulticoreParam(workers = 1),
+                               SIMPLIFY = FALSE)
+   }
+ 
+   print(sum(unlist(results)))
+   print(pbinom(sum(unlist(results)), size = 20, prob = 0.5))
+ })
[1] 11
[1] 0.7482777
── Skip: Error: sample distributions are not expected. ─────────────────────────
Reason: empty test
> 
> test_that("Error: the chosen pvalues should have the smaller variance.", {
+   .structure_diff <- function(pval_mat) {
+     id <- apply(pval_mat[, c(2, 4)], 1, which.min)
+     return(cbind(pval_mat[, c(1, 3)][cbind(seq_along(id), id)],
+                  pval_mat[, c(2, 4)][cbind(seq_along(id), id)]))
+   }
+   for(p in c(0.05, 0.1, 0.2, 0.5)) {
+     p_values <- .Call("test_p_value_change", test_pwm, test_score, adj_mat, snpInfo$prior, snpInfo$transition, score_diff, pval_ratio, quantile(score_diff, 1 - p), 100, package = "atSNP")$score
+     p_values_s <- .structure_diff(p_values)
+     expect_equal(p_values_s[, 2], apply(p_values[, c(2, 4)], 1, min))
+   }
+ })
Test passed with 4 successes 🎉.
> 
> proc.time()
   user  system elapsed 
 15.571   0.641  16.200 

atSNP.Rcheck/tests/test_diff.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(atSNP)
> library(BiocParallel)
> library(testthat)
> data(example)
> 
> trans_mat <- matrix(rep(snpInfo$prior, each = 4), nrow = 4)
> test_pwm <- motif_library$SIX5_disc1
> scores <- as.matrix(motif_scores$motif.scores[3:4, 4:5])
> score_diff <- abs(scores[,2]-scores[,1])
> 
> test_score <- test_pwm
> for(i in seq(nrow(test_score))) {
+   for(j in seq(ncol(test_score))) {
+     test_score[i, j] <- exp(mean(log(test_pwm[i, j] / test_pwm[i, -j])))
+   }
+ }
> 
> adj_mat <- test_pwm + rowMeans(test_pwm)
> motif_len <- nrow(test_pwm)
> 
> ## these are functions for this test only
> drawonesample <- function(theta) {
+     prob_start <- sapply(seq(motif_len),
+                          function(j)
+                              sum(snpInfo$prior * test_score[motif_len + 1 - j, ] ^ theta *
+                                      adj_mat[motif_len + 1 - j, ]) /
+                                          sum(snpInfo$prior * adj_mat[motif_len + 1 - j, ])
+                          )
+     id <- sample(seq(motif_len), 1, prob = prob_start)
+     sample <- sample(1:4, 2 * motif_len - 1, replace = TRUE, prob = snpInfo$prior)
+     delta <- adj_mat
+     delta[motif_len + 1 - id, ] <- delta[motif_len + 1 - id, ] * test_score[motif_len + 1 - id, ] ^ theta
+     sample[id - 1 + seq(motif_len)] <- apply(delta, 1, function(x)
+         sample(seq(4), 1, prob = x * snpInfo$prior))
+     sc <- 0
+     for(s in seq(motif_len)) {
+       delta <- adj_mat
+       delta[motif_len + 1 - s, ] <- delta[motif_len + 1 - s, ] * test_score[motif_len + 1 - s, ] ^ theta
+       sc <- sc + prod(delta[cbind(seq(motif_len), sample[s - 1 + seq(motif_len)])])
+     }
+     sample <- c(sample, id, sc)
+     return(sample)
+ }
> jointprob <- function(x) prod(test_pwm[cbind(seq(motif_len), x)])
> maxjointprob <- function(x) {
+   maxp <- -Inf
+   p <- -Inf
+   for(i in 1:motif_len) {
+     p <- jointprob(x[i:(i+motif_len - 1)])
+     if(p > maxp)
+       maxp <- p
+   }
+   for(i in 1:motif_len) {
+     p <- jointprob(5 - x[(i+motif_len - 1):i])
+     if(p > maxp)
+       maxp <- p
+   }
+   return(maxp)
+ }
> get_freq <- function(sample) {
+   emp_freq <- matrix(0, nrow = 2 * motif_len - 1, ncol = 4)
+   for(i in seq(2 * motif_len - 1)) {
+     for(j in seq(4)) {
+       emp_freq[i, j] <- sum(sample[i, ] == j - 1)
+     }
+   }
+   emp_freq <- emp_freq / rowSums(emp_freq)
+   return(emp_freq)
+ }
> 
> test_that("Error: quantile function computing are not equivalent.", {
+   for(p in c(0.01, 0.1, 0.5, 0.9, 0.99)) {
+     delta <- .Call("test_find_percentile_diff", score_diff, p, package = "atSNP")
+     delta.r <- as.double(sort(abs(scores[,2]-scores[,1]))[ceiling((1 - p) * (nrow(scores)))])
+     expect_equal(delta, delta.r)
+   }
+ })
Test passed with 5 successes 🌈.
> 
> test_that("Error: the scores for samples are not equivalent.", {
+   p <- 0.1
+   delta <- .Call("test_find_percentile_diff", score_diff, p, package = "atSNP")
+   theta <- .Call("test_find_theta_diff", test_score, adj_mat, snpInfo$prior, snpInfo$transition, delta, package = "atSNP")
+   ## Use R code to generate a random sample
+   for(i in seq(10)) {
+     sample <- drawonesample(theta)
+     sample_score <- .Call("test_compute_sample_score_diff", test_pwm, test_score, adj_mat, sample[seq(2 * motif_len - 1)] - 1, sample[2 * motif_len] - 1, theta, package = "atSNP")
+     expect_equal(sample[2 * motif_len + 1], sample_score[1])
+     sample1 <- sample2 <- sample3 <- sample
+     sample1[motif_len] <- seq(4)[-sample[motif_len]][1]
+     sample2[motif_len] <- seq(4)[-sample[motif_len]][2]
+     sample3[motif_len] <- seq(4)[-sample[motif_len]][3]
+     sample_score_r <- log(maxjointprob(sample[seq(2 * motif_len - 1)])) -
+       log(c(maxjointprob(sample1[seq(2 * motif_len - 1)]),
+             maxjointprob(sample2[seq(2 * motif_len - 1)]),
+             maxjointprob(sample3[seq(2 * motif_len - 1)])))
+     expect_equal(sample_score_r, sample_score[-1])
+   }
+   
+   ## Use C code to generate a random sample
+   delta <- matrix(1, nrow = 4 * motif_len, ncol = 2 * motif_len - 1)
+   for(pos in seq(motif_len)) {
+       for(j in (pos + motif_len - 1) : 1) {
+           if(j < pos + motif_len - 1) {
+               delta[4 * (pos - 1) + seq(4), j] <- sum(snpInfo$prior * delta[4 * (pos - 1) + seq(4), j + 1])
+           }
+           if(j >= pos) {
+               delta[4 * (pos - 1) + seq(4), j] <- delta[4 * (pos - 1) + seq(4), j] * adj_mat[j - pos + 1, ]
+           }
+           if(j == motif_len) {
+               delta[4 * (pos - 1) + seq(4), j] <- delta[4 * (pos - 1) + seq(4), j] * test_score[j - pos + 1, ] ^ theta
+           }
+       }
+   }
+   for(i in seq(10)) {
+     sample <- .Call("test_importance_sample_diff", delta, snpInfo$prior, trans_mat, test_pwm, theta, package = "atSNP")
+     start_pos <- sample[2 * motif_len] + 1
+     adj_score <- 0
+     for(s in seq_len(motif_len)) {
+       adj_s <- sum(log(adj_mat[cbind(seq(motif_len), sample[s - 1 + seq(motif_len)] + 1)]))
+       adj_s <- adj_s + theta * log(test_score[motif_len + 1 - s, sample[motif_len] + 1])
+       adj_score <- adj_score + exp(adj_s)
+     }
+     sample_score <- .Call("test_compute_sample_score_diff", test_pwm, test_score, adj_mat, sample[seq(2 * motif_len - 1)], sample[2 * motif_len], theta, package = "atSNP")
+     expect_equal(adj_score, sample_score[1])
+   }
+ })
Test passed with 30 successes 🎉.
> 
> test_that("Error: compute the normalizing constant.", {
+ 
+   ## parameters
+   p <- 0.1
+   delta <- .Call("test_find_percentile_diff", score_diff, p, package = "atSNP")
+   theta <- .Call("test_find_theta_diff", test_score, adj_mat, snpInfo$prior, snpInfo$transition, delta, package = "atSNP")
+   
+   ##
+   const <- .Call("test_func_delta_diff", test_score, adj_mat, snpInfo$prior, trans_mat, theta, package = "atSNP")
+ 
+    prob_start <- sapply(seq(motif_len),
+                          function(j)
+                              sum(snpInfo$prior * test_score[motif_len + 1 - j, ] ^ theta *
+                                      adj_mat[motif_len + 1 - j, ]) /
+                                          sum(snpInfo$prior * adj_mat[motif_len + 1 - j, ])
+                          )
+   
+   const.r <- prod(colSums(snpInfo$prior * t(adj_mat))) * sum(prob_start)
+   expect_equal(const, const.r)
+ })
Test passed with 1 success 😀.
> 
> test_that("Error: sample distributions are not expected.", {
+   
+   ## parameters
+   p <- 0.1
+   delta <- .Call("test_find_percentile_diff", score_diff, p, package = "atSNP")
+   theta <- .Call("test_find_theta_diff", test_score, adj_mat, snpInfo$prior, snpInfo$transition, delta, package = "atSNP")
+ 
+   ## construct the delta matrix
+   delta <- matrix(1, nrow = 4 * motif_len, ncol = 2 * motif_len - 1)
+    for(pos in seq(motif_len)) {
+         for(j in (pos + motif_len - 1) : 1) {
+             if(j < pos + motif_len - 1) {
+                 delta[4 * (pos - 1) + seq(4), j] <- sum(snpInfo$prior * delta[4 * (pos - 1) + seq(4), j + 1])
+             }
+             if(j >= pos) {
+                 delta[4 * (pos - 1) + seq(4), j] <- delta[4 * (pos - 1) + seq(4), j] * adj_mat[j - pos + 1, ]
+             }
+             if(j == motif_len) {
+                 delta[4 * (pos - 1) + seq(4), j] <- delta[4 * (pos - 1) + seq(4), j] * test_score[j - pos + 1, ] ^ theta
+             }
+         }
+     }
+ 
+   target_freq <- matrix(0, nrow = 4, ncol = 2 * motif_len - 1)
+   
+   mat <- snpInfo$prior * matrix(delta[, 1], nrow = 4)
+   wei <- colSums(mat)
+   for(j in seq(2 * motif_len - 1)) {
+       for(pos in seq(motif_len)) {
+           tmp <- delta[seq(4) + 4 * (pos - 1), j] * snpInfo$prior
+           target_freq[, j] <- target_freq[, j] +  tmp / sum(tmp) * wei[pos]
+       }
+   }
+   target_freq <- t(target_freq)
+   target_freq <- target_freq / rowSums(target_freq)
+ 
+   results_i <- function(i) {
+     ## generate 100 samples
+     sample1 <- sapply(seq(100), function(x)
+       .Call("test_importance_sample_diff",
+             delta, snpInfo$prior, trans_mat, test_score, theta, package = "atSNP"))
+     emp_freq1 <- get_freq(sample1)
+     
+     sample2 <- sapply(rep(theta, 100), drawonesample)
+     emp_freq2 <- get_freq(sample2 - 1)
+     
+     ##    print(rbind(emp_freq1[10, ], emp_freq2[10, ], target_freq[10, ]))
+     max(abs(emp_freq1 - target_freq)) > max(abs(emp_freq2 - target_freq))
+   }
+  
+   if(Sys.info()[["sysname"]] == "Windows"){
+     snow <- SnowParam(workers = 1, type = "SOCK")
+     results<-bpmapply(results_i, seq(20), BPPARAM = snow,SIMPLIFY = FALSE)
+   }else{
+     results<-bpmapply(results_i, seq(20), BPPARAM = MulticoreParam(workers = 1),
+                       SIMPLIFY = FALSE)
+   }
+   
+   print(sum(unlist(results)))
+ 
+   print(pbinom(sum(unlist(results)), size = 20, prob = 0.5))
+   
+ })
[1] 13
[1] 0.9423409
── Skip: Error: sample distributions are not expected. ─────────────────────────
Reason: empty test
> 
> test_that("Error: the chosen pvalues should have the smaller variance.", {
+ 
+   .structure_diff <- function(pval_mat) {
+     id <- apply(pval_mat[, c(2, 4)], 1, which.min)
+     return(cbind(pval_mat[, c(1, 3)][cbind(seq_along(id), id)],
+                  pval_mat[, c(2, 4)][cbind(seq_along(id), id)]))
+   }
+   
+   for(p in c(0.05, 0.1, 0.2, 0.5)) {
+     p_values <- .Call("test_p_value_diff", test_pwm, test_score, adj_mat, snpInfo$prior, snpInfo$transition, score_diff, quantile(score_diff, 1 - p), 100, package = "atSNP")
+     p_values_s <- .structure_diff(p_values)
+     expect_equal(p_values_s[, 2], apply(p_values[, c(2, 4)], 1, min))
+   }
+ })
Test passed with 4 successes 🥳.
> 
> proc.time()
   user  system elapsed 
 15.888   0.682  16.565 

atSNP.Rcheck/tests/test_is.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(atSNP)
> library(BiocParallel)
> library(testthat)
> data(example)
> 
> trans_mat <- matrix(rep(snpInfo$prior, each = 4), nrow = 4)
> test_pwm <- motif_library$SIX5_disc1
> scores <- as.matrix(motif_scores$motif.scores[3:4, 4:5])
> 
> motif_len <- nrow(test_pwm)
> 
> ## these are functions for this test only
> drawonesample <- function(theta) {
+   delta <- snpInfo$prior * t(test_pwm ^ theta)
+   delta <- delta / rep(colSums(delta), each = 4)
+   sample <- sample(1:4, 2 * motif_len - 1, replace = TRUE, prob = snpInfo$prior)
+   id <- sample(seq(motif_len), 1)
+   sample[id : (id + motif_len - 1)] <- apply(delta, 2, function(x) sample(1:4, 1, prob = x))
+   sc <- s_cond <- 0
+   for(s in seq(motif_len)) {
+     sc <- sc + prod(test_pwm[cbind(seq(motif_len),
+                                   sample[s : (s + motif_len - 1)])]) ^ theta
+   }
+   s_cond <- prod(test_pwm[cbind(seq(motif_len),
+                                 sample[id : (id + motif_len - 1)])]) ^ theta
+   sample <- c(sample, id, sc, s_cond)
+   return(sample)
+ }
> jointprob <- function(x) prod(test_pwm[cbind(seq(motif_len), x)])
> maxjointprob <- function(x) {
+   maxp <- -Inf
+   p <- -Inf
+   for(i in 1:motif_len) {
+     p <- jointprob(x[i:(i+motif_len - 1)])
+     if(p > maxp)
+       maxp <- p
+   }
+   for(i in 1:motif_len) {
+     p <- jointprob(5 - x[(i+motif_len - 1):i])
+     if(p > maxp)
+       maxp <- p
+   }
+   return(maxp)
+ }
> get_freq <- function(sample) {
+   ids <- cbind(
+                rep(sample[motif_len * 2, ], each = motif_len) + seq(motif_len),
+                rep(seq(100), each = motif_len))
+   sample_motif <- matrix(sample[ids], nrow = motif_len) + 1
+   emp_freq <- matrix(0, nrow = motif_len, ncol = 4)
+   for(i in seq(motif_len)) {
+     for(j in seq(4)) {
+       emp_freq[i, j] <- sum(sample_motif[i, ] == j)
+     }
+   }
+   emp_freq <- emp_freq / rowSums(emp_freq)
+   return(emp_freq)
+ }
> 
> test_that("Error: quantile function computing are not equivalent.", {
+   for(p in c(0.01, 0.1, 0.5, 0.9, 0.99)) {
+     delta <- .Call("test_find_percentile", c(scores), p, package = "atSNP")
+     delta.r <- -sort(-c(scores))[as.integer(p * length(scores)) + 1]
+     expect_equal(delta, delta.r)
+   }
+ })
Test passed with 5 successes 🥳.
> 
> test_that("Error: the scores for samples are not equivalent.", {
+   p <- 0.01
+   delta <- .Call("test_find_percentile", scores, p, package = "atSNP")
+   theta <- .Call("test_find_theta", test_pwm, snpInfo$prior, snpInfo$transition, delta, package = "atSNP")
+   ## Use R code to generate a random sample
+   for(i in seq(10)) {
+     sample <- drawonesample(theta)
+     sample_score <- .Call("test_compute_sample_score", test_pwm, sample[seq(2 * motif_len - 1)] - 1, sample[motif_len * 2] - 1, theta, package = "atSNP")
+     expect_equal(sample[2 * motif_len + 1], sample_score[2])
+     expect_equal(sample[2 * motif_len + 2], sample_score[3])
+   }
+   ## Use C code to generate a random sample
+   for(i in seq(10)) {
+     delta <- t(test_pwm ^ theta)
+     delta <- cbind(matrix(
+                           sum(snpInfo$prior * delta[, 1]),
+                           nrow = 4, ncol = motif_len - 1), delta)
+     sample <- .Call("test_importance_sample", delta, snpInfo$prior, trans_mat, test_pwm, theta, package = "atSNP")
+     start_pos <- sample[motif_len * 2]
+     adj_score <- 0
+     for(s in seq(motif_len) - 1) {
+       adj_score <- adj_score + prod(test_pwm[cbind(seq(motif_len),
+                                                    sample[s + seq(motif_len)] + 1)]) ^ theta
+     }
+     adj_score_cond <- prod(test_pwm[cbind(seq(motif_len), sample[start_pos + seq(motif_len)] + 1)]) ^ theta
+     sample_score <- .Call("test_compute_sample_score", test_pwm, sample[seq(2 * motif_len - 1)], sample[motif_len * 2], theta, package = "atSNP")
+     expect_equal(adj_score, sample_score[2])
+     expect_equal(adj_score_cond, sample_score[3])
+   }
+ })
Test passed with 40 successes 😀.
> 
> test_that("Error: compute the normalizing constant.", {
+   ## parameters
+   p <- 0.01
+   delta <- .Call("test_find_percentile", scores, p, package = "atSNP")
+   theta <- .Call("test_find_theta", test_pwm, snpInfo$prior, snpInfo$transition, delta, package = "atSNP")
+   ##
+   const <- .Call("test_func_delta", test_pwm, snpInfo$prior, trans_mat, theta, package = "atSNP")
+   const.r <- prod(colSums(snpInfo$prior * t(test_pwm) ^ theta)) * motif_len
+   expect_equal(abs(const - const.r) / const < 1e-5, TRUE)
+ })
Test passed with 1 success 😀.
> 
> test_that("Error: sample distributions are not expected.", {
+   ## parameters
+   p <- 0.1
+   delta <- .Call("test_find_percentile", scores, p, package = "atSNP")
+   theta <- .Call("test_find_theta", test_pwm, snpInfo$prior, trans_mat, delta, package = "atSNP")
+   delta <- t(test_pwm ^ theta)
+   delta <- cbind(matrix(
+                         sum(snpInfo$prior * delta[, 1]),
+                         nrow = 4, ncol = motif_len - 1), delta)
+ 
+   results_i <- function(i) {
+     ## generate 100 samples
+     sample <- sapply(seq(100), function(x)
+                      .Call("test_importance_sample",
+                            delta, snpInfo$prior, trans_mat, test_pwm, theta, package = "atSNP"))
+     emp_freq1 <- get_freq(sample)
+     target_freq <- test_pwm ^ theta * snpInfo$prior
+     target_freq <- target_freq / rowSums(target_freq)
+     ## generate samples in R
+     sample <- sapply(rep(theta, 100), drawonesample)
+     emp_freq2 <- get_freq(sample[seq(2 * motif_len), ] - 1)
+     max(abs(emp_freq1 - target_freq)) > max(abs(emp_freq2 - target_freq))
+   }
+ 
+   if(Sys.info()[["sysname"]] == "Windows"){
+     snow <- SnowParam(workers = 1, type = "SOCK")
+     results<-bpmapply(results_i, seq(20), BPPARAM = snow,SIMPLIFY = FALSE)
+   }else{
+     results<-bpmapply(results_i, seq(20), BPPARAM = MulticoreParam(workers = 1),
+                       SIMPLIFY = FALSE)
+   }
+   
+   print(sum(unlist(results)))
+   print(pbinom(sum(unlist(results)), size = 20, prob = 0.5))
+ })
[1] 17
[1] 0.9997988
── Skip: Error: sample distributions are not expected. ─────────────────────────
Reason: empty test
> 
> test_that("Error: the chosen pvalues should have the smaller variance.", {
+   .structure <- function(pval_mat) {
+     id1 <- apply(pval_mat[, c(2, 4)], 1, which.min)
+     return(cbind(
+                  pval_mat[, c(1, 3)][cbind(seq_along(id1), id1)],
+                  pval_mat[, c(2, 4)][cbind(seq_along(id1), id1)])
+            )
+   }
+   for(p in c(0.01, 0.05, 0.1)) {
+     theta <- .Call("test_find_theta", test_pwm, snpInfo$prior, trans_mat, quantile(c(scores), 1 - p), package = "atSNP")
+     p_values <- .Call("test_p_value", test_pwm, snpInfo$prior, snpInfo$transition, c(scores), theta, 100, package = "atSNP")
+     p_values_s <- .structure(p_values)
+     expect_equal(p_values_s[, 2], apply(p_values[, c(2, 4)], 1, min))
+   }
+ })
Test passed with 3 successes 😸.
> 
> proc.time()
   user  system elapsed 
 15.178   0.700  15.868 

Example timings

atSNP.Rcheck/atSNP-Ex.timings

nameusersystemelapsed
ComputeMotifScore0.9200.1090.994
ComputePValues1.1520.3141.268
GetIUPACSequence0.0020.0000.001
LoadFastaData0.3280.0340.362
LoadMotifLibrary0.2180.0250.245
LoadSNPData000
MatchSubsequence0.9010.2371.179
dtMotifMatch1.0380.5161.283
plotMotifMatch 8.541 1.61310.308