Back to Multiple platform build/check report for BioC 3.23:   simplified   long
ABC[D]EFGHIJKLMNOPQRSTUVWXYZ

This page was generated on 2026-05-02 11:35 -0400 (Sat, 02 May 2026).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.4 LTS)x86_644.6.0 RC (2026-04-17 r89917) -- "Because it was There" 4988
kjohnson3macOS 13.7.7 Venturaarm644.6.0 Patched (2026-04-24 r89963) -- "Because it was There" 4718
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 622/2418HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
DNAcycP2 1.4.0  (landing page)
Ji-Ping Wang
Snapshot Date: 2026-05-01 13:40 -0400 (Fri, 01 May 2026)
git_url: https://git.bioconductor.org/packages/DNAcycP2
git_branch: RELEASE_3_23
git_last_commit: 175828d
git_last_commit_date: 2026-04-28 09:04:36 -0400 (Tue, 28 Apr 2026)
nebbiolo1Linux (Ubuntu 24.04.4 LTS) / x86_64  OK    OK    ERROR  
kjohnson3macOS 13.7.7 Ventura / arm64  OK    OK    ERROR    OK  
See other builds for DNAcycP2 in R Universe.


CHECK results for DNAcycP2 on nebbiolo1

To the developers/maintainers of the DNAcycP2 package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/DNAcycP2.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: DNAcycP2
Version: 1.4.0
Command: /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:DNAcycP2.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings DNAcycP2_1.4.0.tar.gz
StartedAt: 2026-05-01 23:44:21 -0400 (Fri, 01 May 2026)
EndedAt: 2026-05-01 23:46:44 -0400 (Fri, 01 May 2026)
EllapsedTime: 143.2 seconds
RetCode: 1
Status:   ERROR  
CheckDir: DNAcycP2.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD check --install=check:DNAcycP2.install-out.txt --library=/home/biocbuild/bbs-3.23-bioc/R/site-library --timings DNAcycP2_1.4.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.23-bioc/meat/DNAcycP2.Rcheck’
* using R version 4.6.0 RC (2026-04-17 r89917)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04.1) 13.3.0
* running under: Ubuntu 24.04.4 LTS
* using session charset: UTF-8
* current time: 2026-05-02 03:44:21 UTC
* checking for file ‘DNAcycP2/DESCRIPTION’ ... OK
* this is package ‘DNAcycP2’ version ‘1.4.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘DNAcycP2’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking line endings in shell scripts ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘DNAcycP2-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: cycle_fasta
> ### Title: Predict Cyclizability
> ### Aliases: cycle_fasta
> 
> ### ** Examples
> 
> # Create a temporary file
> temp_file <- tempfile(fileext = ".fasta")
> writeLines(">1", temp_file)
> writeLines("ACTGCTAGTCACTGCTAGTCACTGCTAGTCACTGCTAGTCACTGCTAGTC", temp_file)
> 
> # Example usage of cycle_fasta
> cycle_fasta(temp_file, smooth=TRUE)
Error in py_call_impl(callable, call_args$unnamed, call_args$named) : 
  ValueError: This FASTA file contains comments at the beginning of the file, which are not
allowed by the 'fasta' parser.

To parse this file, you have three options:

(1) Modify your FASTA file to remove such comments at the beginning of the
file.

(2) Use SeqIO.parse with the 'fasta-pearson' format instead of 'fasta'. This
format is consistent with the FASTA format defined by William Pearson's FASTA
aligner software. This format allows for comments before the first sequence;
lines starting with the ';' character anywhere in the file are also regarded
as comment lines and are ignored.

(3) Use the 'fasta-blast' format. This format regards any lines "starting with
'!', '#', or ';' as comment lines. The 'fasta-blast' format may be safer than
the 'fasta-pearson' format, as it explicitly indicates which lines are comments.

Run `reticulate::py_last_error()` for details.
Calls: cycle_fasta -> basiliskRun -> fun -> <Anonymous> -> py_call_impl
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
       user system elapsed
cycle 4.531  1.207   7.567
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR
See
  ‘/home/biocbuild/bbs-3.23-bioc/meat/DNAcycP2.Rcheck/00check.log’
for details.


Installation output

DNAcycP2.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.23-bioc/R/bin/R CMD INSTALL DNAcycP2
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.23-bioc/R/site-library’
* installing *source* package ‘DNAcycP2’ ...
** this is package ‘DNAcycP2’ version ‘1.4.0’
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (DNAcycP2)

Tests output

DNAcycP2.Rcheck/tests/runTests.Rout


R version 4.6.0 RC (2026-04-17 r89917) -- "Because it was There"
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("DNAcycP2")

Attaching package: 'DNAcycP2'

The following object is masked from 'package:stats':

    cycle

2026-05-01 23:45:07.516747: I tensorflow/core/util/port.cc:111] oneDNN custom operations are on. You may see slightly different numerical results due to floating-point round-off errors from different computation orders. To turn them off, set the environment variable `TF_ENABLE_ONEDNN_OPTS=0`.
2026-05-01 23:45:07.519803: I tensorflow/tsl/cuda/cudart_stub.cc:28] Could not find cuda drivers on your machine, GPU will not be used.
2026-05-01 23:45:07.570196: E tensorflow/compiler/xla/stream_executor/cuda/cuda_dnn.cc:9342] Unable to register cuDNN factory: Attempting to register factory for plugin cuDNN when one has already been registered
2026-05-01 23:45:07.570277: E tensorflow/compiler/xla/stream_executor/cuda/cuda_fft.cc:609] Unable to register cuFFT factory: Attempting to register factory for plugin cuFFT when one has already been registered
2026-05-01 23:45:07.570355: E tensorflow/compiler/xla/stream_executor/cuda/cuda_blas.cc:1518] Unable to register cuBLAS factory: Attempting to register factory for plugin cuBLAS when one has already been registered
2026-05-01 23:45:07.580511: I tensorflow/tsl/cuda/cudart_stub.cc:28] Could not find cuda drivers on your machine, GPU will not be used.
2026-05-01 23:45:07.580855: I tensorflow/core/platform/cpu_feature_guard.cc:182] This TensorFlow binary is optimized to use available CPU instructions in performance-critical operations.
To enable the following instructions: AVX2 AVX512F AVX512_VNNI FMA, in other operations, rebuild TensorFlow with the appropriate compiler flags.
2026-05-01 23:45:08.837280: W tensorflow/compiler/tf2tensorrt/utils/py_utils.cc:38] TF-TRT Warning: Could not find TensorRT
2026-05-01 23:45:10.402576: E tensorflow/compiler/xla/stream_executor/cuda/cuda_driver.cc:268] failed call to cuInit: CUDA_ERROR_NO_DEVICE: no CUDA-capable device is detected
Reading sequences...
Predicting cyclizability...

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 591ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 26ms/step
Reading sequences...
Predicting cyclizability...

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 559ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 28ms/step
Reading sequences...
Predicting cyclizability...

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 510ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 26ms/step
Reading sequences...
Predicting cyclizability...

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 478ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 25ms/step
Reading sequences...
Predicting cyclizability...
WARNING:tensorflow:5 out of the last 9 calls to <function Model.make_predict_function.<locals>.predict_function at 0x76caa933cae0> triggered tf.function retracing. Tracing is expensive and the excessive number of tracings could be due to (1) creating @tf.function repeatedly in a loop, (2) passing tensors with different shapes, (3) passing Python objects instead of tensors. For (1), please define your @tf.function outside of the loop. For (2), @tf.function has reduce_retracing=True option that can avoid unnecessary retracing. For (3), please refer to https://www.tensorflow.org/guide/function#controlling_retracing and https://www.tensorflow.org/api_docs/python/tf/function for  more details.

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 506ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 26ms/step
Sequence length for ID 1: 50
Predicting cyclizability...
Chunk size: 100000, num threads: 1
Sequence length for ID 1: 50
Predicting cyclizability...
Chunk size: 100000, num threads: 1
Reading sequences...
Predicting cyclizability...
WARNING:tensorflow:6 out of the last 11 calls to <function Model.make_predict_function.<locals>.predict_function at 0x76caabf38e00> triggered tf.function retracing. Tracing is expensive and the excessive number of tracings could be due to (1) creating @tf.function repeatedly in a loop, (2) passing tensors with different shapes, (3) passing Python objects instead of tensors. For (1), please define your @tf.function outside of the loop. For (2), @tf.function has reduce_retracing=True option that can avoid unnecessary retracing. For (3), please refer to https://www.tensorflow.org/guide/function#controlling_retracing and https://www.tensorflow.org/api_docs/python/tf/function for  more details.

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 547ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 29ms/step
Reading sequences...
Predicting cyclizability...

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 1s 500ms/step

1/1 [==============================] - ETA: 0s
1/1 [==============================] - 0s 28ms/step


RUNIT TEST PROTOCOL -- Fri May  1 23:45:22 2026 
*********************************************** 
Number of test functions: 0 
Number of errors: 0 
Number of failures: 0 

 
1 Test Suite : 
DNAcycP2 RUnit Tests - 0 test functions, 0 errors, 0 failures
Number of test functions: 0 
Number of errors: 0 
Number of failures: 0 
> 
> proc.time()
   user  system elapsed 
 16.261   1.883  17.131 

Example timings

DNAcycP2.Rcheck/DNAcycP2-Ex.timings

nameusersystemelapsed
cycle4.5311.2077.567