Back to Mac ARM64 build report for BioC 3.18
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2024-04-18 11:32:10 -0400 (Thu, 18 Apr 2024).

HostnameOSArch (*)R versionInstalled pkgs
kjohnson1macOS 13.6.1 Venturaarm644.3.3 (2024-02-29) -- "Angel Food Cake" 4388
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 716/2266HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 1.8.0  (landing page)
Oliver Voogd
Snapshot Date: 2024-04-16 09:00:03 -0400 (Tue, 16 Apr 2024)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: RELEASE_3_18
git_last_commit: 8b72098
git_last_commit_date: 2023-10-24 11:34:56 -0400 (Tue, 24 Oct 2023)
kjohnson1macOS 13.6.1 Ventura / arm64  OK    OK    ERROR    OK  

CHECK results for FLAMES on kjohnson1


To the developers/maintainers of the FLAMES package:
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 1.8.0
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.8.0.tar.gz
StartedAt: 2024-04-17 13:48:54 -0400 (Wed, 17 Apr 2024)
EndedAt: 2024-04-17 13:58:42 -0400 (Wed, 17 Apr 2024)
EllapsedTime: 587.9 seconds
RetCode: 1
Status:   ERROR  
CheckDir: FLAMES.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.8.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.18-bioc-mac-arm64/meat/FLAMES.Rcheck’
* using R version 4.3.3 (2024-02-29)
* using platform: aarch64-apple-darwin20 (64-bit)
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 12.2.0
* running under: macOS Ventura 13.6.1
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.8.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.18-bioc-mac-arm64/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotation_to_fasta: no visible global function definition for
  'write.table'
generate_sc_sce: no visible binding for global variable 'FSM_match'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
  'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
  'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
  variable 'heatmap_annotation_colors'
sc_umap_expression: no visible binding for global variable
  'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
  'x'
sc_umap_expression : plot_idx: no visible binding for global variable
  'y'
transcript_coverage: no visible binding for global variable 'mat'
Undefined global functions or variables:
  . BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt
  everything gene_id heatmap_annotation_colors label length_bin mat n
  name tr_id transcript transcript_id value write.table x y
Consider adding
  importFrom("utils", "write.table")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘FLAMES-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: sc_heatmap_expression
> ### Title: FLAMES heetmap plots
> ### Aliases: sc_heatmap_expression
> 
> ### ** Examples
> 
> combined_sce <- combine_sce(
+     short_read_large = scmixology_lib90,
+     short_read_small = scmixology_lib10,
+     long_read_sce = scmixology_lib10_transcripts,
+     remove_duplicates = FALSE)
Warning: sampleMap[['assay']] coerced with as.factor()
> sc_heatmap_expression(gene = "ENSG00000108107", multiAssay = combined_sce)
Running PCA for experiments(multiAssay)$gene_counts ...
harmonizing input:
  removing 257 sampleMap rows with 'colname' not in colnames of experiments
  removing 236 colData rownames not in sampleMap 'primary'
Running UMAP for experiments(multiAssay)$gene_counts ...
Error in irlba::irlba(L, nv = n, nu = 0, maxit = iters) : 
  function 'as_cholmod_sparse' not provided by package 'Matrix'
Calls: sc_heatmap_expression ... irlba_tsvd_normalized_laplacian_init -> irlba_spectral_tsvd
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 5 NOTEs
See
  ‘/Users/biocbuild/bbs-3.18-bioc-mac-arm64/meat/FLAMES.Rcheck/00check.log’
for details.


Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/zlibbioc/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/zlibbioc/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c flexiplex.cpp -o flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/zlibbioc/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /Library/Frameworks/R.framework/Versions/4.3-arm64/Resources/library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.3.3 (2024-02-29) -- "Angel Food Cake"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20 (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpSx8wZQ/file12c8d530acd05/config_file_76941.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpSx8wZQ/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
> 
> proc.time()
   user  system elapsed 
 26.060   1.054  27.245 

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
annotation_to_fasta1.5270.0981.636
blaze0.3750.0612.394
bulk_long_pipeline0.7700.1081.776
combine_sce1.7030.0271.743
create_config0.0080.0010.010
create_sce_from_dir0.1970.0210.223
create_se_from_dir0.8170.0770.920
cutadapt0.0000.0000.001
filter_annotation0.5760.0040.583
find_barcode0.1550.0120.167
find_isoform1.3510.0741.434
get_GRangesList2.5240.0782.616
locate_minimap2_dir0.0020.0050.009
minimap2_align0.9410.0641.022
minimap2_realign1.7760.0731.870
parse_gff_tree0.9790.0261.008
plot_coverage3.1920.0753.293
plot_demultiplex0.5960.0400.638
quantify_transcript6.9270.1517.108
sc_DTU_analysis0.1400.0200.174