##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘crisprDesign/DESCRIPTION’ ... OK
* this is package ‘crisprDesign’ version ‘1.4.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘crisprDesign’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘crisprDesign-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: addCompositeScores
> ### Title: Add on-target composite score to a GuideSet object.
> ### Aliases: addCompositeScores addCompositeScores,GuideSet-method
> ###   addCompositeScores,PairedGuideSet-method
> ###   addCompositeScores,NULL-method
> 
> ### ** Examples
> 
> gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA")
> gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater"))
[addOnTargetScores] Adding ruleset1 scores. 

Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 1 out-of-bound range located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
[addOnTargetScores] Adding crisprater scores. 

Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’/home/biocbuild/R/R-4.3.1/bin/BATCH: line 60: 874648 Killed                  ${R_HOME}/bin/R -f ${in} ${opts} ${R_BATCH_OPTIONS} > ${out} 2>&1

 ERROR
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
  > library(testthat)
  > library(crisprDesign)
  Loading required package: crisprBase
  > 
  > test_check("crisprDesign")
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 NOTE
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL crisprDesign
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’
* installing *source* package ‘crisprDesign’ ...
** using staged installation
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (crisprDesign)

R version 4.3.1 (2023-06-16) -- "Beagle Scouts"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(crisprDesign)
Loading required package: crisprBase
> 
> test_check("crisprDesign")