| Back to Multiple platform build/check report for BioC 3.18: simplified long | 
 | 
This page was generated on 2023-11-02 11:40:34 -0400 (Thu, 02 Nov 2023).
| Hostname | OS | Arch (*) | R version | Installed pkgs | 
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 22.04.2 LTS) | x86_64 | 4.3.1 (2023-06-16) -- "Beagle Scouts" | 4729 | 
| palomino4 | Windows Server 2022 Datacenter | x64 | 4.3.1 (2023-06-16 ucrt) -- "Beagle Scouts" | 4463 | 
| lconway | macOS 12.6.5 Monterey | x86_64 | 4.3.1 Patched (2023-06-17 r84564) -- "Beagle Scouts" | 4478 | 
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | 4.3.1 (2023-06-16) -- "Beagle Scouts" | 4464 | 
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 456/2266 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| crisprDesign 1.4.0  (landing page) Jean-Philippe Fortin 
 | nebbiolo2 | Linux (Ubuntu 22.04.2 LTS) / x86_64 | OK | OK | OK |  | ||||||||
| palomino4 | Windows Server 2022 Datacenter / x64 | OK | OK | OK | OK |  | ||||||||
| lconway | macOS 12.6.5 Monterey / x86_64 | OK | OK | OK | OK |  | ||||||||
| kjohnson1 | macOS 13.6.1 Ventura / arm64 | see weekly results here | ||||||||||||
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | ERROR | ||||||||||
| To the developers/maintainers of the crisprDesign package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/crisprDesign.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. - See Martin Grigorov's blog post for how to debug Linux ARM64 related issues on a x86_64 host. | 
| Package: crisprDesign | 
| Version: 1.4.0 | 
| Command: /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz | 
| StartedAt: 2023-11-02 09:38:53 -0000 (Thu, 02 Nov 2023) | 
| EndedAt: 2023-11-02 09:47:20 -0000 (Thu, 02 Nov 2023) | 
| EllapsedTime: 507.1 seconds | 
| RetCode: 1 | 
| Status: ERROR | 
| CheckDir: crisprDesign.Rcheck | 
| Warnings: NA | 
##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘crisprDesign/DESCRIPTION’ ... OK
* this is package ‘crisprDesign’ version ‘1.4.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘crisprDesign’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘crisprDesign-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: addCompositeScores
> ### Title: Add on-target composite score to a GuideSet object.
> ### Aliases: addCompositeScores addCompositeScores,GuideSet-method
> ###   addCompositeScores,PairedGuideSet-method
> ###   addCompositeScores,NULL-method
> 
> ### ** Examples
> 
> gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA")
> gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater"))
[addOnTargetScores] Adding ruleset1 scores. 
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 1 out-of-bound range located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
[addOnTargetScores] Adding crisprater scores. 
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’/home/biocbuild/R/R-4.3.1/bin/BATCH: line 60: 874648 Killed                  ${R_HOME}/bin/R -f ${in} ${opts} ${R_BATCH_OPTIONS} > ${out} 2>&1
 ERROR
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
  > library(testthat)
  > library(crisprDesign)
  Loading required package: crisprBase
  > 
  > test_check("crisprDesign")
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 2 ERRORs, 1 NOTE
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck/00check.log’
for details.
crisprDesign.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL crisprDesign ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’ * installing *source* package ‘crisprDesign’ ... ** using staged installation ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (crisprDesign)
crisprDesign.Rcheck/tests/testthat.Rout.fail
R version 4.3.1 (2023-06-16) -- "Beagle Scouts"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> library(testthat)
> library(crisprDesign)
Loading required package: crisprBase
> 
> test_check("crisprDesign")
crisprDesign.Rcheck/crisprDesign-Ex.timings
| name | user | system | elapsed | |
| GuideSet-class | 0.204 | 0.008 | 0.223 | |
| GuideSet2DataFrames | 1.421 | 0.114 | 1.717 | |
| PairedGuideSet-class | 0.548 | 0.012 | 0.563 | |
| TxDb2GRangesList | 0.000 | 0.000 | 0.001 | |