Back to Multiple platform build/check report for BioC 3.18:   simplified   long
AB[C]DEFGHIJKLMNOPQRSTUVWXYZ

This page was generated on 2023-11-02 11:40:34 -0400 (Thu, 02 Nov 2023).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo2Linux (Ubuntu 22.04.2 LTS)x86_644.3.1 (2023-06-16) -- "Beagle Scouts" 4729
palomino4Windows Server 2022 Datacenterx644.3.1 (2023-06-16 ucrt) -- "Beagle Scouts" 4463
lconwaymacOS 12.6.5 Montereyx86_644.3.1 Patched (2023-06-17 r84564) -- "Beagle Scouts" 4478
kunpeng2Linux (openEuler 22.03 LTS-SP1)aarch644.3.1 (2023-06-16) -- "Beagle Scouts" 4464
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 456/2266HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
crisprDesign 1.4.0  (landing page)
Jean-Philippe Fortin
Snapshot Date: 2023-11-01 14:05:06 -0400 (Wed, 01 Nov 2023)
git_url: https://git.bioconductor.org/packages/crisprDesign
git_branch: RELEASE_3_18
git_last_commit: 47405b3
git_last_commit_date: 2023-10-24 11:43:12 -0400 (Tue, 24 Oct 2023)
nebbiolo2Linux (Ubuntu 22.04.2 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
palomino4Windows Server 2022 Datacenter / x64  OK    OK    OK    OK  UNNEEDED, same version is already published
lconwaymacOS 12.6.5 Monterey / x86_64  OK    OK    OK    OK  UNNEEDED, same version is already published
kjohnson1macOS 13.6.1 Ventura / arm64see weekly results here
kunpeng2Linux (openEuler 22.03 LTS-SP1) / aarch64  OK    OK    ERROR  

CHECK results for crisprDesign on kunpeng2


To the developers/maintainers of the crisprDesign package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/crisprDesign.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.
- See Martin Grigorov's blog post for how to debug Linux ARM64 related issues on a x86_64 host.

raw results


Summary

Package: crisprDesign
Version: 1.4.0
Command: /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz
StartedAt: 2023-11-02 09:38:53 -0000 (Thu, 02 Nov 2023)
EndedAt: 2023-11-02 09:47:20 -0000 (Thu, 02 Nov 2023)
EllapsedTime: 507.1 seconds
RetCode: 1
Status:   ERROR  
CheckDir: crisprDesign.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:crisprDesign.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings crisprDesign_1.4.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘crisprDesign/DESCRIPTION’ ... OK
* this is package ‘crisprDesign’ version ‘1.4.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘crisprDesign’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘crisprDesign-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: addCompositeScores
> ### Title: Add on-target composite score to a GuideSet object.
> ### Aliases: addCompositeScores addCompositeScores,GuideSet-method
> ###   addCompositeScores,PairedGuideSet-method
> ###   addCompositeScores,NULL-method
> 
> ### ** Examples
> 
> gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA")
> gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater"))
[addOnTargetScores] Adding ruleset1 scores. 

Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 1 out-of-bound range located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
[addOnTargetScores] Adding crisprater scores. 

Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE) :
  GRanges object contains 2 out-of-bound ranges located on sequence
  region_1. Note that ranges located on a sequence whose length is
  unknown (NA) or on a circular sequence are not considered out-of-bound
  (use seqlengths() and isCircular() to get the lengths and circularity
  flags of the underlying sequences). You can use trim() to trim these
  ranges. See ?`trim,GenomicRanges-method` for more information.
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’/home/biocbuild/R/R-4.3.1/bin/BATCH: line 60: 874648 Killed                  ${R_HOME}/bin/R -f ${in} ${opts} ${R_BATCH_OPTIONS} > ${out} 2>&1

 ERROR
Running the tests in ‘tests/testthat.R’ failed.
Complete output:
  > library(testthat)
  > library(crisprDesign)
  Loading required package: crisprBase
  > 
  > test_check("crisprDesign")
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 NOTE
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/crisprDesign.Rcheck/00check.log’
for details.


Installation output

crisprDesign.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL crisprDesign
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’
* installing *source* package ‘crisprDesign’ ...
** using staged installation
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (crisprDesign)

Tests output

crisprDesign.Rcheck/tests/testthat.Rout.fail


R version 4.3.1 (2023-06-16) -- "Beagle Scouts"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(crisprDesign)
Loading required package: crisprBase
> 
> test_check("crisprDesign")

Example timings

crisprDesign.Rcheck/crisprDesign-Ex.timings

nameusersystemelapsed
GuideSet-class0.2040.0080.223
GuideSet2DataFrames1.4210.1141.717
PairedGuideSet-class0.5480.0120.563
TxDb2GRangesList0.0000.0000.001