##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:Biostrings.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings Biostrings_2.70.1.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/Biostrings.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘Biostrings/DESCRIPTION’ ... OK
* this is package ‘Biostrings’ version ‘2.70.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘Biostrings’ can be installed ... OK
* used C compiler: ‘gcc (GCC) 10.3.1’
* checking installed package size ... NOTE
  installed size is 14.8Mb
  sub-directories of 1Mb or more:
    R         1.7Mb
    extdata  11.1Mb
    libs      1.1Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Package listed in more than one of Depends, Imports, Suggests, Enhances:
  ‘methods’
A package should be listed in only one of these fields.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... WARNING
Undocumented code objects:
  ‘strsplit’ ‘twoWayAlphabetFrequency’
Undocumented S4 methods:
  generic 'hasOnlyBaseLetters' and siglist 'AAString'
  generic 'hasOnlyBaseLetters' and siglist 'AAStringSet'
  generic 'match' and siglist 'Vector,XStringSet'
  generic 'match' and siglist 'XStringSet,Vector'
  generic 'match' and siglist 'XStringSet,vector'
  generic 'match' and siglist 'vector,XStringSet'
  generic 'parallel_slot_names' and siglist 'ByPos_MIndex'
  generic 'parallel_slot_names' and siglist 'MIndex'
  generic 'pcompare' and siglist 'Vector,XStringSet'
  generic 'pcompare' and siglist 'XStringSet,Vector'
  generic 'pcompare' and siglist 'XStringSet,vector'
  generic 'pcompare' and siglist 'vector,XStringSet'
  generic 'relistToClass' and siglist 'XString'
  generic 'strsplit' and siglist 'XStringSet'
  generic 'twoWayAlphabetFrequency' and siglist 'XString,XString'
  generic 'twoWayAlphabetFrequency' and siglist 'XString,XStringSet'
  generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XString'
  generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XStringSet'
  generic 'unstrsplit' and siglist 'XStringSet'
  generic 'unstrsplit' and siglist 'XStringSetList'
  generic 'updateObject' and siglist 'AAString'
  generic 'updateObject' and siglist 'AAStringSet'
All user-level objects in a package (including S4 classes and methods)
should have documentation entries.
See chapter ‘Writing R documentation files’ in the ‘Writing R
Extensions’ manual.
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘Biostrings-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: findPalindromes
> ### Title: Searching a sequence for palindromes
> ### Aliases: findPalindromes findPalindromes,XString-method
> ###   findPalindromes,DNAString-method findPalindromes,RNAString-method
> ###   findPalindromes,XStringViews-method
> ###   findPalindromes,MaskedXString-method palindromeArmLength
> ###   palindromeArmLength,XString-method
> ###   palindromeArmLength,DNAString-method
> ###   palindromeArmLength,RNAString-method
> ###   palindromeArmLength,XStringViews-method
> ###   palindromeArmLength,XStringSet-method palindromeLeftArm
> ###   palindromeRightArm palindromeLeftArm,XString-method
> ###   palindromeRightArm,XString-method
> ###   palindromeLeftArm,XStringViews-method
> ###   palindromeRightArm,XStringViews-method
> ### Keywords: methods
> 
> ### ** Examples
> 
> x0 <- BString("abbbaabbcbbaccacabbbccbcaabbabacca")
> 
> pals0a <- findPalindromes(x0, min.armlength=3, max.looplength=5)
> pals0a
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     3   8     6 [bbaabb]
  [2]     6  12     7 [abbcbba]
  [3]    10  19    10 [bbaccacabb]
> palindromeArmLength(pals0a)
[1] 3 3 4
> palindromeLeftArm(pals0a)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     3   5     3 [bba]
  [2]     6   8     3 [abb]
  [3]    10  13     4 [bbac]
> palindromeRightArm(pals0a)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     6   8     3 [abb]
  [2]    10  12     3 [bba]
  [3]    16  19     4 [cabb]
> 
> pals0b <- findPalindromes(x0, min.armlength=9, max.looplength=5,
+                           max.mismatch=3)
> pals0b
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     1  29    29 [abbbaabbcbbaccacabbbccbcaabba]
  [2]    10  28    19 [bbaccacabbbccbcaabb]
  [3]     8  30    23 [bcbbaccacabbbccbcaabbab]
  [4]    12  34    23 [accacabbbccbcaabbabacca]
> palindromeArmLength(pals0b, max.mismatch=3)
[1] 11  9  9 11
> palindromeLeftArm(pals0b, max.mismatch=3)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     1  11    11 [abbbaabbcbb]
  [2]    10  18     9 [bbaccacab]
  [3]     8  16     9 [bcbbaccac]
  [4]    12  22    11 [accacabbbcc]
> palindromeRightArm(pals0b, max.mismatch=3)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]    19  29    11 [bbccbcaabba]
  [2]    20  28     9 [bccbcaabb]
  [3]    22  30     9 [cbcaabbab]
  [4]    24  34    11 [caabbabacca]
> 
> ## Whitespaces matter:
> x1 <- BString("Delia saw I was aileD")
> palindromeArmLength(x1)
[1] 10
> palindromeLeftArm(x1)
10-letter BString object
seq: Delia saw 
> palindromeRightArm(x1)
10-letter BString object
seq:  was aileD
> 
> x2 <- BString("was it a car or a cat I saw")
> palindromeArmLength(x2)
[1] 4
> palindromeLeftArm(x2)
4-letter BString object
seq: was 
> palindromeRightArm(x2)
4-letter BString object
seq:  saw
> 
> ## On a DNA or RNA sequence:
> x3 <- DNAString("CCGAAAACCATGATGGTTGCCAG")
> findPalindromes(x3)
Views on a 23-letter DNAString subject
subject: CCGAAAACCATGATGGTTGCCAG
views:
      start end width
  [1]     6  18    13 [AACCATGATGGTT]
> findPalindromes(RNAString(x3))
Views on a 23-letter RNAString subject
subject: CCGAAAACCAUGAUGGUUGCCAG
views:
      start end width
  [1]     6  18    13 [AACCAUGAUGGUU]
> 
> ## Note that palindromes can be nested:
> x4 <- DNAString("ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT")
> findPalindromes(x4, max.looplength=19)
Views on a 34-letter DNAString subject
subject: ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT
views:
      start end width
  [1]     1  11    11 [ACGTTNAACGT]
  [2]     1  27    27 [ACGTTNAACGTCCAAAATTTTCCACGT]
  [3]    14  21     8 [AAAATTTT]
  [4]     7  28    22 [AACGTCCAAAATTTTCCACGTT]
  [5]     8  34    27 [ACGTCCAAAATTTTCCACGTTNAACGT]
  [6]    24  34    11 [ACGTTNAACGT]
> 
> ## Treat wobble base pairings as matches:
> x5 <- RNAString("AUGUCUNNNNAGGCGU")
> findPalindromes(x5, max.looplength=4, min.looplength=4)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views: NONE
> findPalindromes(x5, max.looplength=4, min.looplength=4, max.mismatch=2)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views:
      start end width
  [1]     1  16    16 [AUGUCUNNNNAGGCGU]
> findPalindromes(x5, max.looplength=4, min.looplength=4, allow.wobble=TRUE)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views:
      start end width
  [1]     1  16    16 [AUGUCUNNNNAGGCGU]
> 
> ## A real use case:
> library(BSgenome.Dmelanogaster.UCSC.dm3)
Loading required package: BSgenome
Loading required package: GenomicRanges
Loading required package: BiocIO
Loading required package: rtracklayer

Attaching package: ‘rtracklayer’

The following object is masked from ‘package:BiocIO’:

    FileForFormat

> chrX <- Dmelanogaster$chrX
> chrX_pals0 <- findPalindromes(chrX, min.armlength=40, max.looplength=80)
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘run_unitTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 1 WARNING, 3 NOTEs
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/Biostrings.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD INSTALL Biostrings
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.3.1/site-library’
* installing *source* package ‘Biostrings’ ...
** using staged installation
** libs
using C compiler: ‘gcc (GCC) 10.3.1’
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c BAB_class.c -o BAB_class.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c BitMatrix.c -o BitMatrix.o
BitMatrix.c:299:13: warning: ‘BitMatrix_print’ defined but not used [-Wunused-function]
  299 | static void BitMatrix_print(BitMatrix *bitmat)
      |             ^~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c IRanges_stubs.c -o IRanges_stubs.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c MIndex_class.c -o MIndex_class.o
MIndex_class.c: In function ‘SparseMIndex_endIndex’:
MIndex_class.c:184:20: warning: unused variable ‘poffsets_order’ [-Wunused-variable]
  184 |  IntAE *poffsets, *poffsets_order;
      |                    ^~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c PreprocessedTB_class.c -o PreprocessedTB_class.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c R_init_Biostrings.c -o R_init_Biostrings.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c RoSeqs_utils.c -o RoSeqs_utils.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c S4Vectors_stubs.c -o S4Vectors_stubs.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c SparseList_utils.c -o SparseList_utils.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c XStringSetList_class.c -o XStringSetList_class.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c XStringSet_class.c -o XStringSet_class.o
XStringSet_class.c: In function ‘new_XStringSet_from_CHARACTER’:
XStringSet_class.c:124:3: warning: ‘lkup_len’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  124 |   _copy_CHARSXP_to_Chars_holder(&ans_elt_holder, x_elt,
      |   ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
  125 |     INTEGER(start)[i], lkup0, lkup_len);
      |     ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c XString_class.c -o XString_class.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c XVector_stubs.c -o XVector_stubs.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c align_needwunsQS.c -o align_needwunsQS.o
align_needwunsQS.c: In function ‘align_needwunsQS’:
align_needwunsQS.c:155:22: warning: ‘sc’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  155 |  INTEGER(ans_elt)[0] = score;
      |  ~~~~~~~~~~~~~~~~~~~~^~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c align_pairwiseAlignment.c -o align_pairwiseAlignment.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c align_utils.c -o align_utils.o
align_utils.c: In function ‘PairwiseAlignmentsSingleSubject_align_aligned’:
align_utils.c:250:14: warning: ‘indelWidthSubject’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  250 |     jPattern += indelWidthSubject;
      |     ~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
align_utils.c:231:42: warning: ‘indelStartSubject’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  231 |    if ((numberOfIndelSubject == 0) || (j < indelStartSubject)) {
      |                                       ~~~^~~~~~~~~~~~~~~~~~~~
align_utils.c:239:30: warning: ‘indelWidthPattern’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  239 |       mappedStringPtr[index] = gapCodeValue;
      |       ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~
align_utils.c:232:50: warning: ‘indelStartPattern’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  232 |     if ((numberOfIndelPattern == 0) || (jPattern < indelStartPattern)) {
      |                                        ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c find_palindromes.c -o find_palindromes.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c gtestsim.c -o gtestsim.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c inject_code.c -o inject_code.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c letter_frequency.c -o letter_frequency.o
letter_frequency.c: In function ‘XStringSet_two_way_letter_frequency’:
letter_frequency.c:957:48: warning: unused variable ‘x_pos’ [-Wunused-variable]
  957 |   int x_width, y_width, x_length, *ans_mat, i, x_pos;
      |                                                ^~~~~
letter_frequency.c:956:13: warning: unused variable ‘ans_dimnames’ [-Wunused-variable]
  956 |   SEXP ans, ans_dimnames;
      |             ^~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c lowlevel_matching.c -o lowlevel_matching.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_PWM.c -o match_PWM.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pattern.c -o match_pattern.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pattern_boyermoore.c -o match_pattern_boyermoore.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pattern_indels.c -o match_pattern_indels.o
match_pattern_indels.c:7:13: warning: ‘test_match_pattern_indels’ defined but not used [-Wunused-function]
    7 | static void test_match_pattern_indels(const char *p, const char *s,
      |             ^~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pattern_shiftor.c -o match_pattern_shiftor.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pdict.c -o match_pdict.o
match_pdict.c: In function ‘vmatch_PDict3Parts_XStringSet’:
match_pdict.c:419:12: warning: ‘ans_col’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  419 |    ans_col += tb_length;
      |    ~~~~~~~~^~~~~~~~~~~~
match_pdict.c:392:58: note: ‘ans_col’ was declared here
  392 |  int tb_length, S_length, collapse0, i, j, match_count, *ans_col;
      |                                                          ^~~~~~~
match_pdict.c: In function ‘vmatch_XStringSet_XStringSet’:
match_pdict.c:470:13: warning: ‘ans_elt’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  470 |     ans_elt += P_length;
      |     ~~~~~~~~^~~~~~~~~~~
match_pdict.c:441:57: note: ‘ans_elt’ was declared here
  441 |  int P_length, S_length, collapse0, i, j, match_count, *ans_elt;
      |                                                         ^~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pdict_ACtree2.c -o match_pdict_ACtree2.o
match_pdict_ACtree2.c: In function ‘split_and_move_pointers’:
match_pdict_ACtree2.c:1031:10: warning: variable ‘node0’ set but not used [-Wunused-but-set-variable]
 1031 |  ACnode *node0, *node1, *node2;
      |          ^~~~~
match_pdict_ACtree2.c: In function ‘merge_pointers’:
match_pdict_ACtree2.c:1076:10: warning: variable ‘node0’ set but not used [-Wunused-but-set-variable]
 1076 |  ACnode *node0, *node1, *node2;
      |          ^~~~~
At top level:
match_pdict_ACtree2.c:602:21: warning: ‘a_nice_max_nodeextbuf_nelt’ defined but not used [-Wunused-function]
  602 | static unsigned int a_nice_max_nodeextbuf_nelt(int nnodes)
      |                     ^~~~~~~~~~~~~~~~~~~~~~~~~~
match_pdict_ACtree2.c:139:13: warning: ‘debug_node_counting_functions’ defined but not used [-Wunused-function]
  139 | static void debug_node_counting_functions(int maxdepth)
      |             ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pdict_Twobit.c -o match_pdict_Twobit.o
match_pdict_Twobit.c: In function ‘build_Twobit’:
match_pdict_Twobit.c:75:20: warning: ‘twobit_sign2pos’ may be used uninitialized in this function [-Wmaybe-uninitialized]
   75 |  PROTECT(ans_elt = new_XInteger_from_tag("XInteger", twobit_sign2pos));
      |                    ^~~~~~~~~~~~~~~~~~~~~
match_pdict_Twobit.c:110:12: note: ‘twobit_sign2pos’ was declared here
  110 |  SEXP ans, twobit_sign2pos;
      |            ^~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_pdict_utils.c -o match_pdict_utils.o
match_pdict_utils.c: In function ‘match_ppheadtail0’:
match_pdict_utils.c:653:49: warning: unused variable ‘ncol’ [-Wunused-variable]
  653 |  int nelt, min_safe_tb_end, max_safe_tb_end, j, ncol;
      |                                                 ^~~~
match_pdict_utils.c: In function ‘match_ppheadtail’:
match_pdict_utils.c:713:6: warning: unused variable ‘nelt’ [-Wunused-variable]
  713 |  int nelt, nkey0, nkey1, nkey2, i, key;
      |      ^~~~
match_pdict_utils.c: In function ‘_match_pdict_all_flanks’:
match_pdict_utils.c:820:44: warning: unused variable ‘subtotal_NFC’ [-Wunused-variable]
  820 |  static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
      |                                            ^~~~~~~~~~~~
match_pdict_utils.c:820:27: warning: unused variable ‘total_NFC’ [-Wunused-variable]
  820 |  static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
      |                           ^~~~~~~~~
match_pdict_utils.c:819:33: warning: unused variable ‘NFC’ [-Wunused-variable]
  819 |  unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
      |                                 ^~~
match_pdict_utils.c:819:26: warning: unused variable ‘nloci’ [-Wunused-variable]
  819 |  unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
      |                          ^~~~~
match_pdict_utils.c:819:20: warning: unused variable ‘ndup’ [-Wunused-variable]
  819 |  unsigned long int ndup, nloci, NFC; // NFC = Number of Flank Comparisons
      |                    ^~~~
At top level:
match_pdict_utils.c:820:27: warning: ‘total_NFC’ defined but not used [-Wunused-variable]
  820 |  static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
      |                           ^~~~~~~~~
match_pdict_utils.c:820:44: warning: ‘subtotal_NFC’ defined but not used [-Wunused-variable]
  820 |  static unsigned long int total_NFC = 0UL, subtotal_NFC = 0UL;
      |                                            ^~~~~~~~~~~~
match_pdict_utils.c:261:13: warning: ‘match_headtail_by_loc’ defined but not used [-Wunused-function]
  261 | static void match_headtail_by_loc(const HeadTail *headtail,
      |             ^~~~~~~~~~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c match_reporting.c -o match_reporting.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c matchprobes.c -o matchprobes.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c pmatchPattern.c -o pmatchPattern.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c read_fasta_files.c -o read_fasta_files.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c read_fastq_files.c -o read_fastq_files.o
read_fastq_files.c: In function ‘parse_FASTQ_file’:
read_fastq_files.c:394:7: warning: ‘dont_load’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  394 |    if (dont_load || loader->new_empty_seq_hook == NULL)
      |       ^
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c replaceAt.c -o replaceAt.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c replace_letter_at.c -o replace_letter_at.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c strutils.c -o strutils.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c translate.c -o translate.o
translate.c: In function ‘DNAStringSet_translate’:
translate.c:110:8: warning: ‘if_ambig0’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  110 |     if (if_ambig == TRANSLATE_ERROR) {
      |        ^
translate.c:136:29: note: ‘if_ambig0’ was declared here
  136 |  int ncodes, if_non_ambig0, if_ambig0, ans_length, i, errcode;
      |                             ^~~~~~~~~
translate.c:106:8: warning: ‘if_non_ambig0’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  106 |     if (if_non_ambig == TRANSLATE_TO_X)
      |        ^
translate.c:136:14: note: ‘if_non_ambig0’ was declared here
  136 |  int ncodes, if_non_ambig0, if_ambig0, ans_length, i, errcode;
      |              ^~~~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c unstrsplit_methods.c -o unstrsplit_methods.o
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c utils.c -o utils.o
utils.c: In function ‘_get_twobit_signature’:
utils.c:157:9: warning: ‘twobit_sign’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  157 |  return twobit_sign;
      |         ^~~~~~~~~~~
utils.c: In function ‘_get_twobit_signature_at’:
utils.c:164:12: warning: ‘twobit_sign’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  164 |  int i, j, twobit_sign;
      |            ^~~~~~~~~~~
gcc -I"/home/biocbuild/R/R-4.3.1/include" -DNDEBUG  -I'/home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include' -I'/home/biocbuild/R/R-4.3.1/site-library/IRanges/include' -I'/home/biocbuild/R/R-4.3.1/site-library/XVector/include' -I/usr/local/include    -fPIC  -g -O2  -Wall -c xscat.c -o xscat.o
In file included from /home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include/S4Vectors_defines.h:18,
                 from /home/biocbuild/R/R-4.3.1/site-library/IRanges/include/IRanges_defines.h:18,
                 from ../inst/include/Biostrings_defines.h:18,
                 from Biostrings.h:1,
                 from xscat.c:1:
xscat.c: In function ‘XString_xscat’:
/home/biocbuild/R/R-4.3.1/include/Rdefines.h:91:21: warning: ‘ans_length’ may be used uninitialized in this function [-Wmaybe-uninitialized]
   91 | #define NEW_RAW(n)  Rf_allocVector(RAWSXP,n)
      |                     ^~~~~~~~~~~~~~
xscat.c:18:13: note: ‘ans_length’ was declared here
   18 |  int nargs, ans_length, tag_offset, j;
      |             ^~~~~~~~~~
xscat.c:52:16: warning: ‘ans_classname’ may be used uninitialized in this function [-Wmaybe-uninitialized]
   52 |  PROTECT(ans = new_XRaw_from_tag(ans_classname, ans_tag));
      |                ^~~~~~~~~~~~~~~~~
In file included from /home/biocbuild/R/R-4.3.1/site-library/S4Vectors/include/S4Vectors_defines.h:18,
                 from /home/biocbuild/R/R-4.3.1/site-library/IRanges/include/IRanges_defines.h:18,
                 from ../inst/include/Biostrings_defines.h:18,
                 from Biostrings.h:1,
                 from xscat.c:1:
xscat.c: In function ‘XStringSet_xscat’:
/home/biocbuild/R/R-4.3.1/include/Rdefines.h:85:25: warning: ‘ans_length’ may be used uninitialized in this function [-Wmaybe-uninitialized]
   85 | #define NEW_INTEGER(n)  Rf_allocVector(INTSXP,n)
      |                         ^~~~~~~~~~~~~~
xscat.c:66:32: note: ‘ans_length’ was declared here
   66 |  int nargs, *arg_lengths, *ii, ans_length, i, j, *width;
      |                                ^~~~~~~~~~
xscat.c:108:16: warning: ‘ans_element_type’ may be used uninitialized in this function [-Wmaybe-uninitialized]
  108 |  PROTECT(ans = _alloc_XStringSet(ans_element_type, ans_width));
      |                ^~~~~~~~~~~~~~~~~
gcc -shared -L/home/biocbuild/R/R-4.3.1/lib -L/usr/local/lib -o Biostrings.so BAB_class.o BitMatrix.o IRanges_stubs.o MIndex_class.o PreprocessedTB_class.o R_init_Biostrings.o RoSeqs_utils.o S4Vectors_stubs.o SparseList_utils.o XStringSetList_class.o XStringSet_class.o XString_class.o XVector_stubs.o align_needwunsQS.o align_pairwiseAlignment.o align_utils.o find_palindromes.o gtestsim.o inject_code.o letter_frequency.o lowlevel_matching.o match_PWM.o match_pattern.o match_pattern_boyermoore.o match_pattern_indels.o match_pattern_shiftor.o match_pdict.o match_pdict_ACtree2.o match_pdict_Twobit.o match_pdict_utils.o match_reporting.o matchprobes.o pmatchPattern.o read_fasta_files.o read_fastq_files.o replaceAt.o replace_letter_at.o strutils.o translate.o unstrsplit_methods.o utils.o xscat.o -L/home/biocbuild/R/R-4.3.1/lib -lR
installing to /home/biocbuild/R/R-4.3.1/site-library/00LOCK-Biostrings/00new/Biostrings/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
in method for ‘twoWayAlphabetFrequencyByQuality’ with signature ‘"QualityScaledXStringSet"’: no definition for class “QualityScaledXStringSet”
Creating a new generic function for ‘strsplit’ in package ‘Biostrings’
Creating a generic function for ‘ls’ from package ‘base’ in package ‘Biostrings’
Creating a new generic function for ‘pattern’ in package ‘Biostrings’
Creating a new generic function for ‘offset’ in package ‘Biostrings’
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (Biostrings)

R version 4.3.1 (2023-06-16) -- "Beagle Scouts"
Copyright (C) 2023 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> require("Biostrings") || stop("unable to load Biostrings package")
Loading required package: Biostrings
Loading required package: BiocGenerics

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append,
    as.data.frame, basename, cbind, colnames, dirname, do.call,
    duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
    lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin,
    pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table,
    tapply, union, unique, unsplit, which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:utils':

    findMatches

The following objects are masked from 'package:base':

    I, expand.grid, unname

Loading required package: IRanges
Loading required package: XVector
Loading required package: GenomeInfoDb

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

[1] TRUE
> Biostrings:::.test()


RUNIT TEST PROTOCOL -- Thu Nov  2 08:51:26 2023 
*********************************************** 
Number of test functions: 41 
Number of errors: 0 
Number of failures: 0 

 
1 Test Suite : 
Biostrings RUnit Tests - 41 test functions, 0 errors, 0 failures
Number of test functions: 41 
Number of errors: 0 
Number of failures: 0 
Warning messages:
1: In XStringSet("DNA", x, start = start, end = end, width = width,  :
  metadata columns on input DNAStringSet object were dropped
2: In XStringSet("DNA", x, start = start, end = end, width = width,  :
  metadata columns on input DNAStringSet object were dropped
3: In XStringSet("DNA", x, start = start, end = end, width = width,  :
  metadata columns on input DNAStringSet object were dropped
> 
> proc.time()
   user  system elapsed 
 11.889   0.272  12.217