hiReadsProcessor 1.2.0 Nirav V Malani
| Snapshot Date: 2015-10-08 17:20:21 -0700 (Thu, 08 Oct 2015) | | URL: https://hedgehog.fhcrc.org/bioconductor/branches/RELEASE_3_1/madman/Rpacks/hiReadsProcessor | | Last Changed Rev: 102591 / Revision: 109384 | | Last Changed Date: 2015-04-16 12:42:01 -0700 (Thu, 16 Apr 2015) |
| zin2 | Linux (Ubuntu 14.04.2 LTS) / x86_64 | NotNeeded | OK | ERROR | | |
| moscato2 | Windows Server 2008 R2 Enterprise SP1 (64-bit) / x64 | NotNeeded | OK | ERROR | OK | |
| petty | Mac OS X Snow Leopard (10.6.8) / x86_64 | NotNeeded | OK | [ ERROR ] | OK | |
| morelia | Mac OS X Mavericks (10.9.5) / x86_64 | NotNeeded | OK | ERROR | OK | |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --no-vignettes --timings hiReadsProcessor_1.2.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.1-bioc/meat/hiReadsProcessor.Rcheck’
* using R version 3.2.2 Patched (2015-08-14 r69078)
* using platform: x86_64-apple-darwin10.8.0 (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘hiReadsProcessor/DESCRIPTION’ ... OK
* this is package ‘hiReadsProcessor’ version ‘1.2.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘hiReadsProcessor’ can be installed ... [36s/38s] OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Malformed Title field: should not end in a period.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
chunkize: no visible global function definition for ‘breakInChunks’
chunkize: no visible global function definition for ‘detectCores’
decodeByBarcode: no visible global function definition for ‘metadata<-’
decodeByBarcode: no visible global function definition for ‘metadata’
extractSeqs : <anonymous>: no visible global function definition for
‘metadata’
extractSeqs : <anonymous> : <anonymous> : <anonymous>: no visible
global function definition for ‘IRanges’
extractSeqs : <anonymous> : <anonymous>: no visible global function
definition for ‘IRanges’
findBarcodes: no visible global function definition for ‘metadata<-’
findBarcodes: no visible global function definition for ‘metadata’
findIntegrations : <anonymous>: no visible global function definition
for ‘IRanges’
findVector : <anonymous>: no visible global function definition for
‘IRanges’
pairwiseAlignSeqs: no visible global function definition for
‘IRangesList’
pairwiseAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for
‘IRangesList’
pslToRangedObject: no visible global function definition for ‘IRanges’
read.BAMasPSL: no visible global function definition for ‘ScanBamParam’
read.BAMasPSL: no visible global function definition for ‘scanBamFlag’
read.BAMasPSL: no visible global function definition for ‘DataFrame’
read.sampleInfo: no visible global function definition for ‘SimpleList’
read.SeqFolder: no visible global function definition for ‘SimpleList’
vpairwiseAlignSeqs: no visible global function definition for ‘Rle’
vpairwiseAlignSeqs: no visible global function definition for
‘runLength’
vpairwiseAlignSeqs: no visible global function definition for ‘IRanges’
vpairwiseAlignSeqs: no visible global function definition for
‘runValue’
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking installed files from ‘inst/doc’ ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘hiReadsProcessor-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: replicateReads
> ### Title: Replicate sequences from DNAStringSet object using counts
> ### identifier or vector
> ### Aliases: replicateReads
>
> ### ** Examples
>
> dnaSet <- c("CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG",
+ "ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA",
+ "CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC",
+ "CCTGAATCCTGGCAATGTCATCATC", "ATCCTGGCAATGTCATCATCAATGG",
+ "ATCAGTTGTCAACGGCTAATACGCG", "ATCAATGGCGATTGCCGCGTCTGCA",
+ "CCGCGTCTGCAATGTGAGGGCCTAA", "GAAGGATGCCAGTTGAAGTTCACAC")
> dnaSet <- dereplicateReads(dnaSet)
No names attribute found in dnaSet object...using artifically generated names
> replicateReads(dnaSet)
Warning in replicateReads(dnaSet) : NAs introduced by coercion
Error in replicateReads(dnaSet) :
No counts=X marker found at the end of definition line or names attribute in dnaSet object
Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 2 NOTEs
See
‘/Users/biocbuild/bbs-3.1-bioc/meat/hiReadsProcessor.Rcheck/00check.log’
for details.
* installing *source* package ‘hiReadsProcessor’ ...
** R
** data
** inst
** preparing package for lazy loading
Creating a generic function for ‘nchar’ from package ‘base’ in package ‘S4Vectors’
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
Creating a generic function for ‘nchar’ from package ‘base’ in package ‘S4Vectors’
* DONE (hiReadsProcessor)