Back to the "Multiple platform build/check report" A  B  C  D  E  F [G] H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z 

Package 156/419HostnameOS / ArchBUILDCHECKBUILD BIN
GeneR 2.20.0
Y. d'Aubenton-Carafa
Snapshot Date: 2011-04-06 23:24:01 -0700 (Wed, 06 Apr 2011)
URL: https://hedgehog.fhcrc.org/bioconductor/branches/RELEASE_2_7/madman/Rpacks/GeneR
Last Changed Rev: 50293 / Revision: 54588
Last Changed Date: 2010-10-17 22:34:23 -0700 (Sun, 17 Oct 2010)
lamb2 Linux (openSUSE 11.2) / x86_64  OK [ ERROR ]
liverpool Windows Server 2003 R2 (32-bit) / x64  OK  OK  OK 
gewurz Windows Server 2008 R2 Enterprise (64-bit) / x64  OK  ERROR  OK 

Summary

Package: GeneR
Version: 2.20.0
Command: /home/biocbuild/bbs-2.7-bioc/R/bin/R CMD check --no-vignettes --timings GeneR_2.20.0.tar.gz
StartedAt: 2011-04-07 06:31:18 -0700 (Thu, 07 Apr 2011)
EndedAt: 2011-04-07 06:31:43 -0700 (Thu, 07 Apr 2011)
EllapsedTime: 24.5 seconds
RetCode: 1
Status:  ERROR 
CheckDir: GeneR.Rcheck
Warnings: NA

Command output

* using log directory ‘/loc/home/biocbuild/bbs-2.7-bioc/meat/GeneR.Rcheck’
* using R version 2.12.2 (2011-02-25)
* using platform: x86_64-unknown-linux-gnu (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘GeneR/DESCRIPTION’ ... OK
* this is package ‘GeneR’ version ‘2.20.0’
* checking package name space information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking whether package ‘GeneR’ can be installed ... OK
* checking package directory ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the name space can be loaded with stated dependencies ... OK
* checking whether the name space can be unloaded cleanly ... OK
* checking for unstated dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
and.segSet: possible error in as.segSet(deb, fin): unused argument(s)
  (fin)
relist: no visible global function definition for ‘error’
setParam: no visible global function definition for ‘seqSize’
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking examples ... ERROR
Running examples in ‘GeneR-Ex.R’ failed
The error most likely occurred in:

> assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: GeneR
> ### Title: Overview of GeneR package
> ### Aliases: GeneR
> ### Keywords: utilities
> 
> ### ** Examples
> 
> ## First of all you can try
> demo(GeneR)


	demo(GeneR)
	---- ˜˜˜˜˜

> ##              G E N E R   
> ##               D E M O   
> 
> cat ("\n\n            G E N E R  \n             D E M O \n\n")


            G E N E R  
             D E M O 


> cat("\n------ First, play with character string !  -------\n")

------ First, play with character string !  -------

> s <- "gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa"

> cat("\n------  Get the reverse complementary: -------\n")

------  Get the reverse complementary: -------

> strComp(s)
[1] "ttgttagactgtcacctagacgcattttaactgtcacctagcatgcatgac"

> readline("Next")
Next
[1] ""

> cat("\n------ Insert a poly A into sequence -------\n")

------ Insert a poly A into sequence -------

> s2 <- insertSeq(s,"aaaaaaaaaaaaaa",20) 

> s2
[1] "gtcatgcatgctaggtgacaaaaaaaaaaaaaaagttaaaatgcgtctaggtgacagtctaacaa"

> cat("\n------ Count mono nucleotides, di-nucleotides !!! -------\n")

------ Count mono nucleotides, di-nucleotides !!! -------

> strCompoSeq(s2,wsize=1)
       T         C         A   G X
[1,] 0.2 0.1384615 0.4615385 0.2 0

> strCompoSeq(s2,wsize=2)
     TT TC      TA     TG TX      CT CC      CA CG CX      AT AC      AA     AG
[1,]  0  0 0.03125 0.0625  0 0.09375  0 0.15625  0  0 0.03125  0 0.28125 0.0625
     AX     GT      GC     GA GG GX XT XC XA XG XX
[1,]  0 0.1875 0.03125 0.0625  0  0  0  0  0  0  0

> readline("Next")
Next
[1] ""

> cat ("\n------ Get some data from the web !! -------\n")

------ Get some data from the web !! -------

> seqNcbi("BY608190",file='toto.fa')
Warning in seqNcbi("BY608190", file = "toto.fa") :
  Because NCBI changed the web service the seqNcbi() function needs to connect to, the function is broken. Please contact the maintainer of the GeneR package about this. Thanks!
trying URL 'http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&qty=1&c_start=1&send=Send&sendto=t&from=begin&to=end&extrafeatpresent=1&ef_MGC=16&dopt=fasta&list_uids=BY608190'
Warning in download.file(urldemande, destfile = file) :
  cannot open: HTTP status was '404 Not Found'
Error in download.file(urldemande, destfile = file) : 
  cannot open URL 'http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&qty=1&c_start=1&send=Send&sendto=t&from=begin&to=end&extrafeatpresent=1&ef_MGC=16&dopt=fasta&list_uids=BY608190'
Calls: demo ... eval.with.vis -> eval.with.vis -> seqNcbi -> download.file
Execution halted

GeneR.Rcheck/00install.out:

* installing *source* package ‘GeneR’ ...
** libs
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c GeneR_glob.cc -o GeneR_glob.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c GeneR_seq.cc -o GeneR_seq.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c complementaire.cc -o complementaire.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c compoSeq.cc -o compoSeq.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c dnaRna.cc -o dnaRna.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c libIndex.cc -o libIndex.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c libStrings.cc -o libStrings.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c makeIndex.cc -o makeIndex.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c masked.cc -o masked.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c misc.cc -o misc.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readEmblDescript.cc -o readEmblDescript.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readIndex.cc -o readIndex.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readLocation.cc -o readLocation.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readSeqEmbl.cc -o readSeqEmbl.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readSeqFasta.cc -o readSeqFasta.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c readSeqGbk.cc -o readSeqGbk.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c seqManip.cc -o seqManip.o
gcc -std=gnu99 -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c strcasestr.c -o strcasestr.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c translate.cc -o translate.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c upperSeq.cc -o upperSeq.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c vecteurs.cc -o vecteurs.o
g++ -I/home/biocbuild/bbs-2.7-bioc/R/include  -I/usr/local/include    -fpic  -g -O2 -c writeFasta.cc -o writeFasta.o
g++ -shared -L/usr/local/lib64 -o GeneR.so GeneR_glob.o GeneR_seq.o complementaire.o compoSeq.o dnaRna.o libIndex.o libStrings.o makeIndex.o masked.o misc.o readEmblDescript.o readIndex.o readLocation.o readSeqEmbl.o readSeqFasta.o readSeqGbk.o seqManip.o strcasestr.o translate.o upperSeq.o vecteurs.o writeFasta.o -L/home/biocbuild/bbs-2.7-bioc/R/lib -lR
installing to /loc/home/biocbuild/bbs-2.7-bioc/meat/GeneR.Rcheck/GeneR/libs
** R
** demo
** inst
** preparing package for lazy loading
** help
*** installing help indices
** building package indices ...
** testing if installed package can be loaded

* DONE (GeneR)

GeneR.Rcheck/GeneR-Ex.timings:

nameusersystemelapsed