This document describes the usage of the functions integrated in the package and is meant to be a reference document for the end user.
The ORFhunteR package is considered stable and will undergo few changes from now on. Please, report potential bugs and incompatibilities to bioinformatics.rfct.bio.bsu@gmail.com.
The usage of the package functions for an automatic determination and
annotation of open reading frames (ORFs) is shown for an example set of
50 mRNA molecules loaded from the Ensembl. The path to the data set
trans_sequences.fasta is available as
Load the package with the following command:
if (!requireNamespace("BiocManager", quietly = TRUE)) {
install.packages("BiocManager")
}
BiocManager::install("ORFhunteR")library('ORFhunteR')
#> Loading required package: Biostrings
#> Loading required package: BiocGenerics
#> Loading required package: generics
#>
#> Attaching package: 'generics'
#> The following objects are masked from 'package:base':
#>
#> as.difftime, as.factor, as.ordered, intersect, is.element, setdiff,
#> setequal, union
#>
#> Attaching package: 'BiocGenerics'
#> The following objects are masked from 'package:stats':
#>
#> IQR, mad, sd, var, xtabs
#> The following objects are masked from 'package:base':
#>
#> anyDuplicated, aperm, append, as.data.frame, basename, cbind,
#> colnames, dirname, do.call, duplicated, eval, evalq, Filter, Find,
#> get, grep, grepl, is.unsorted, lapply, Map, mapply, match, mget,
#> order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
#> rbind, Reduce, rownames, sapply, saveRDS, table, tapply, unique,
#> unsplit, which.max, which.min
#> Loading required package: S4Vectors
#> Loading required package: stats4
#>
#> Attaching package: 'S4Vectors'
#> The following object is masked from 'package:utils':
#>
#> findMatches
#> The following objects are masked from 'package:base':
#>
#> expand.grid, I, unname
#> Loading required package: IRanges
#> Loading required package: XVector
#> Loading required package: Seqinfo
#>
#> Attaching package: 'Biostrings'
#> The following object is masked from 'package:base':
#>
#> strsplit
#> Loading required package: rtracklayer
#> Loading required package: GenomicRanges
#> Loading required package: Peptides
#> Warning: replacing previous import 'stringr::str_wrap' by 'xfun::str_wrap' when
#> loading 'ORFhunteR'The most important data sets are available with package as an external data. Furthermore, a number of additional data used in this vignette can be downloaded from our SST Center server.
You can load the data file of the mRNA molecules with the following command:
where the function argument tr is a character string
giving the name of file with transcripts of interest. Allowed file
formats are fasta or fa. Alternative formats
are gtf or gff. With gtf or
gff formats, additional argument genome should be
specified. This argument gives the name of pre-installed BSgenome data
package with full genome sequences. Default value is
BSgenome.Hsapiens.UCSC.hg38. Irrespective used format of
input file, the function loadTrExper returns a list of
loaded transcript sequences. Each element of this list is character
string of nucleotides sequence.
All possible in-frame ORF candidates in a sequence of interest can be
determined by function findORFs:
x <- "AAAATGGCTGCGTAATGCAAAATGGCTGCGAATGCAAAATGGCTGCGAATGCCGGCACGTTGCTACGT"
orf <- findORFs(x, codStart="ATG")where the function argument x is a character string
giving the nucleotide sequence of interest. In current implementation,
the function findORFs scans the sequence for all
sub-sequences that start with ATG start codon and end in-frame with a
stop codon. The function findORFs returns a matrix with start and stop
positions in RNA molecule, length and sequence of identified variants of
ORFs. In fact, the predominant amount of identified ORF candidates are
short pseudo-ORFs (see below), as demonstrated in Figure 1.
Figure 1. Distribution of the length of ORF candidates from lncRNAs and
mRNAs and length of true ORFs derived from NCBI RefSeq annotations of
human genes. This figure is based on NCBI RefSeq release 109 (GRCh38.p12
human genome assembly).
#Vectorization of the sequence features of ORFs The function
vectorizeORFs extracts and vectorizes the sequences
features of ORFs:
where the function argument x is a DNAStringSet object
with ORF sequence. For each ORF, the function vectorizeORFs
calculates 104 sequence features: frequency of mono-, di- and
trinucleotides (84 features in total), parameters of the Bao model
representing the local frequency entropy values of sequences (12
features in total) (Bao J. et al., 2014), correlation factors of
nucleotides and length of ORF (8 features in total). As was shown in
numerous studies, these features are informative for classification of
coding and non-coding RNA molecules. This function returns the object of
class data.frame with ORF vectorized into sequence features.
#Calculation of the classification model
The function classifyORFsCandidates builds a
randomForest classifier for the ORF candidates:
## The files with sequences can be downloaded from SST Center server at www.sstcenter.com/download/ORFhunteR
fileORFLncRNAs <- "http://www.sstcenter.com/download/ORFhunteR/NCBI_RefSeq_release_109_GRCh38.p12_ORF_candidates_sequences_lncRNAs.fasta.gz"
ORFLncRNAs <- loadTrExper(tr = fileORFLncRNAs)
fileORFmRNAs <- "http://www.sstcenter.com/download/ORFhunteR/NCBI_RefSeq_release_109_GRCh38.p12_ORFs_true_sequences_mRNAs.fasta.gz"
ORFmRNAs <- loadTrExper(tr = fileORFmRNAs)
## Make the train dataset from N pseudo- and N real ORFs.
N <- 1000
ORFLncRNAs <- ORFLncRNAs[1:N]
ORFmRNAs <- ORFmRNAs[1:N]
## Calculate the classification model for the open reading frame.
clt <- classifyORFsCandidates(ORFLncRNAs = ORFLncRNAs,
ORFmRNAs = ORFmRNAs,
pLearn = 0.75,
nTrees = 500,
modelRF = NULL,
workDir = NULL,
showAccuracy = TRUE)where the function argument ORFLncRNAs is the object of
the class list of pseudo-ORFs, ORFmRNAs is the object of
the class list of coding true ORFs, pLearn is a threshold,
in fractions of one, for random selecting the train set of ORFs (the
rest amount, or 1-pLearn, is thus left for the test set of ORFs; default
value is 0.75), nTrees is a number of trees to grow (this
should not be set to too small a number, to ensure that every input row
gets predicted at least a few times; default value is 500),
modelRF is character string, giving the name of RDS-file to
store the classification model (NULL is by default), and
workDir is character string giving the path to and the name
of the work directory (NULL is by default that means the current working
directory). Here and below, pseudo-ORFs are nucleotide sequences of long
non-coding RNA molecules that beginning with ATG start codon and ending
in-frame with one of the stop codons, but these sequences are not
translated into proteins. We also use this term for non-coding
mRNA-derived nucleotide sequences (usually short) with features of
ORFs.
The function classifyORFsCandidates returns an object of
class randomForest (Liaw A. et al., 2002) that can be used for
subsequent automatic determination of ORFs in experimental RNA molecules
of interest. In addition, the function automatically saves the RDS file
of the classification model modelRF into the directory
workDir and generates: i) the randomForest type plots: the
sorted variable importance, the error rates, and the dotchart of
variable importance as measured by a classification model; ii) the
evaluation estimates of the classification model on the train and test
datasets: the confusion matrix and the measures of Accuracy, Precision,
Recall, and the Score F1, calculated as
Accuracy \[Accuracy = \frac{TP + TN}{TP + TN + FP + FN}\] Precision \[Precision = \frac{TP}{TP + FP}\] Recall \[Recall = \frac{TP}{TP + FN}\] The Score F1 \[The Score F1 = \frac{2 * TP}{2 * TP + FP + FN}\]
where TP – true positive (the positive class is predicted as the positive class number); FN – false negative (the positive class is predicted as the negative class number); FP – false positive (the negative class is predicted as the positive class number); TN – true negative (the negative class is predicted as the negative class number).
With calculated classification model, identification of the true ORFs
among ORF candidates extracted from RNA molecules of interest can be
done using function predictORF:
model <- "http://www.sstcenter.com/download/ORFhunteR/classRFmodel_1.rds"
ORFs <- predictORF(tr = trans,
model= model,
prThr = 0)where the function argument tr is a character string
giving the name of file with transcripts of interest, model
is a character string giving the connection or full path to the file
from which the classification model is read, and argument
prThr is probability threshold for the “winning” class of
ORFs (default value is 0). Allowed file formats for transcripts of
interest are fasta or fa. Alternative formats
are gtf or gff. With gtf or
gff formats, additional argument genome should
be specified. This argument gives the name of pre-installed BSgenome
data package with full genome sequences. Default value is
“BSgenome.Hsapiens.UCSC.hg38”. The function predictORF
returns an object of class data.frame with five fields:
head(ORFs)
#> transcript_id start end length prob
#> 1 ENST00000235453 279 1469 1191 1.000
#> 2 ENST00000246505 36 1397 1362 1.000
#> 3 ENST00000258105 21 359 339 0.948
#> 4 ENST00000278833 542 1597 1056 1.000
#> 5 ENST00000285021 216 3038 2823 1.000
#> 6 ENST00000302797 219 1187 969 1.000The function predictORFselects only one ORF candidate
per RNA molecule that was assigned with maximal value of
prob field. In fact, 91.9% of ORFs that were identified in
mRNA molecules (Ensembl release 97, GRCh38.p12 human reference genome
assembly) demonstrates probability (Figure 2).
Figure 2. Empirical cumulative distribution (a) and frequency (b) of
probability values for ORFs that were identified in Ensembl human mRNA
molecules. At the same time, distribution of probability values for ORF
candidates from long non-coding RNA molecules is completely differ
(Figure 3). This difference between two classes of RNA molecules makes
it possible to set a probability threshold prThr that discriminates
pseudo- and true ORFs.
Figure 3. Boxplot demonstrating the distribution of probability values
for ORFs that were identified in human mRNAs and lncRNAs (Ensembl
release 97, GRCh38.p12 human reference genome assembly).
The sequences of identified can be extracted with function
getSeqORFs:
orfs_path <- system.file("extdata",
"Set.trans_ORFs.coordinates.txt",
package="ORFhunteR")
tr_path <- system.file("extdata",
"Set.trans_sequences.fasta",
package="ORFhunteR")
seq_orfs <- getSeqORFs(orfs = orfs_path,
tr = tr_path,
genome="BSgenome.Hsapiens.UCSC.hg38",
workDir=NULL)This function needs the name of tab-delimited TXT file with
coordinates of ORFs (as generated by function predictORF)
and the name of file with transcripts of interest. The last file must
include the transcripts for which the ORFs were identified and listed in
above file with coordinates of ORFs. Allowed file formats for
transcripts of interest are fasta or fa.
Alternative formats are gtf or gff. With
gtf or gff formats, additional argument
genome should be specified. This argument gives the name of
pre-installed BSgenome data package with full genome sequences. Default
value is BSgenome.Hsapiens.UCSC.hg38. The output of
function getSeqORFs is a DNAStringSet object with sequences
of ORFs:
head(seq_orfs)
#> DNAStringSet object of length 6:
#> width seq names
#> [1] 1191 ATGGCGGCAGCTCCACGGGAGGA...ATGATTATCCATTTTCTCAATAA ENST00000235453
#> [2] 1362 ATGGCGCACATTACCATTAACCA...CTCCCCTGTCCACGGTGTGTTGA ENST00000246505
#> [3] 339 ATGGCAGCTGCCTTGGCTCGGCT...CGGGCGCTGATACTGGTCGCTGA ENST00000258105
#> [4] 1056 ATGGCGCCGGTGTTGCCCCTGGT...AGGAGGATCTATCTGAGGCCTAG ENST00000278833
#> [5] 2823 ATGGCTCGGAAACGCGCGGCCGG...TGTTCCCATTTGAGCAGCTGTGA ENST00000285021
#> [6] 969 ATGGATCCAACCATCTCAACCTT...CGGGAAGCAGATTGGAGCAGTGA ENST00000302797With identified ORFs, the PTCs can be inferred using function
findPTCs:
orfs_path <- system.file("extdata",
"Set.trans_ORFs.coordinates.txt",
package="ORFhunteR")
gtf_path <- system.file("extdata",
"Set.trans_sequences.gtf",
package="ORFhunteR")
ptcs <- findPTCs(orfs = orfs_path,
gtf = gtf_path,
workDir = NULL)This function needs the name of tab-delimited TXT file with
coordinates of ORFs (as generated by function predictORF)
and the name of file with structure of transcripts in format
gtf or gff. The output of function
findPTCs is an object of class data.frame with field
stop.status:
head(ptcs)
#> transcript_id start end length prob stop.status
#> 1 ENST00000235453 279 1469 1191 1.000 mature
#> 2 ENST00000246505 36 1397 1362 1.000 mature
#> 3 ENST00000258105 21 359 339 0.904 premature
#> 4 ENST00000278833 542 1597 1056 1.000 mature
#> 5 ENST00000285021 216 3038 2823 1.000 mature
#> 6 ENST00000302797 219 1187 969 1.000 matureIn silico translation of identified ORFs can be done with function
translateORFs:
seq_orf_path <- system.file("extdata",
"Set.trans_ORFs.sequences.fasta",
package="ORFhunteR")
prot_seqs <- translateORFs(seqORFs=seq_orf_path)This function accepts fasta (or fa) file
with sequences of identified ORFs (as generated by function
getSeqORFs) and translates these sequences into strings of
amino acids according to standard genetic code. The output of function
translateORFs is an AAStringSet object with amino acid
sequences:
head(prot_seqs)
#> AAStringSet object of length 6:
#> width seq names
#> [1] 396 MAAAPREEKRWPQPVFSNPVVLW...EEITSGGFCGGKDKLQYDYPFSQ ENST00000235453
#> [2] 453 MAHITINQYLQQVYEAIDSRDGA...ISHQHQKLVVSKQNPFPPLSTVC ENST00000246505
#> [3] 112 MAAALARLGLRPVKQVRVQFCPF...FASHIRARDAAGSGDKPGADTGR ENST00000258105
#> [4] 351 MAPVLPLVLPLQPRIRLAQGLWL...ACRPAPEEAPPGEAPPKEDLSEA ENST00000278833
#> [5] 940 MARKRAAGGEPRGRELRSQKSKA...GGPKKTKREKKAAASHLFPFEQL ENST00000285021
#> [6] 322 MDPTISTLDTELTPINGTEETLC...EVDEGGGQLPEEILELSGSRLEQ ENST00000302797If necessary, the coding of amino acid symbols can be switched from
one-letter to three-letter using argument aaSymbol of
function.
The package ORFhunteR includes function annotateORFs for
basic annotation of identified ORFs. This function works according to
following syntax:
orfs_path <- system.file("extdata",
"Set.trans_ORFs.coordinates.txt",
package="ORFhunteR")
tr_path <- system.file("extdata",
"Set.trans_sequences.fasta",
package="ORFhunteR")
gtf_path <- system.file("extdata",
"Set.trans_sequences.gtf",
package="ORFhunteR")
prts_path <- system.file("extdata",
"Set.trans_proteins.sequences.fasta",
package="ORFhunteR")
anno_orfs <- annotateORFs(orfs = orfs_path,
tr = tr_path,
gtf = gtf_path,
prts = prts_path,
workDir = NULL)The function annotateORFs needs five arguments. The
argument orfs is the name of tab-delimited TXT file with
coordinates of ORFs (as generated by function predictORF). The argument
tr is a character string giving the name of file with
transcripts of interest. This file must include the transcripts for
which the ORFs were identified and listed in above file with coordinates
of ORFs. Allowed file formats for transcripts of interest are
fasta or fa. The argument gtf is
the name of file with structure of transcripts in format
gtf or gff. The argument prts is
a character string giving the name of fasta file with
sequences of in silico translated proteins encoded by identified ORFs
(as generated by function translateORFs). The last argument
workDir is a character string giving the path to and name
of work directory (NULL by default that mean the current working
directory). The function annotateORFs returns an object of
class data.frame. This object includes information on each analysed
transcript: transcript ID, length of 5’UTRs, type of start codon, start
coordinate of ORF, stop coordinate of ORF, type of stop codon, PTC
status of stop codon, length of ORF, length of 3’UTRs, molecular weight
of in silico translated protein, isoelectic point of a protein sequence
and potential protein interaction index.
head(anno_orfs)
#> transcript_id f_utr.length start.codon orf.start orf.stop stop.codon
#> 1 ENST00000235453 278 ATG 279 1469 TAA
#> 2 ENST00000246505 35 ATG 36 1397 TGA
#> 3 ENST00000258105 20 ATG 21 359 TGA
#> 4 ENST00000278833 541 ATG 542 1597 TAG
#> 5 ENST00000285021 215 ATG 216 3038 TGA
#> 6 ENST00000302797 218 ATG 219 1187 TGA
#> stop.status orf.length t_utr.length MW pI indexPPI
#> 1 mature 1191 726 44.90 6.59 1.25
#> 2 mature 1362 389 52.10 8.61 1.19
#> 3 premature 339 137 12.11 8.98 1.96
#> 4 mature 1056 281 37.21 5.97 0.46
#> 5 mature 2823 794 105.95 9.30 2.60
#> 6 mature 969 3 36.25 7.57 0.13If you use the ORFhunteR package for a scientific work, then please cite (Yatskou M. M. et al., 2019) and (Skakun V. V. et al., 2020).
Bao J., Yuan R., Bao Z. An improved alignment-free model for DNA sequence similarity metric. // BMC Bioinformatics. – 2014. – Vol. 15. – P. 321. doi: 10.1186/1471-2105-15-321
Liaw A., Wiener M. Classification and regression by randomForest. // R News. – 2002. – Vol. 2. – P. 18-22.
ORFhunteR: an accurate approach for the automatic identification and annotation of open reading frames in human mRNA molecules. Vasily V. Grinev, Mikalai M. Yatskou, Victor V. Skakun, Maryna K. Chepeleva, Petr V. Nazarov. bioRxiv 2021.02.05.429963; doi: https://doi.org/10.1101/2021.02.05.429963
Skakun V. V., Yatskou M. M., Nazarov P. V., Grinev V. V. ORFhunteR software package for automatic detection of open reading frames in human RNA molecules. // Computer Technology and Data Analysis (CTDA’2020): materials of the II International Scientific and Practical Conference, Minsk, 23-24 April 2020 / Editorial board: Skakun V. V. (editor-in-chief) [and others]. – Minsk: BSU, 2020. pp. 20-24.
Yatskou M. M., Skakun V. V., Grinev V. V. Development of a computational approach for automatic determination of open reading frames in human RNA molecules. // Quantum electronics: materials of the XII International Scientific and Technical Conference, Minsk, 18-22 November 2019 / Editorial board: Kugeiko M. M. [and others]. – Minsk: RIVSH, 2019. pp. 279-281.