Analyzing Cellular DNA Barcode with CellBarcode

library(data.table)
library(ggplot2)
library(CellBarcode)

Introduction

About the package

What’s this package used for?

Cellular DNA barcoding (genetic lineage tracing) is a powerful tool for lineage tracing and clonal tracking studies. This package provides a toolbox for DNA barcode analysis, from extraction from fastq files to barcode error correction and quantification.

What types of barcode can this package handle?

The package can handle all kinds of barcodes, as long as the barcodes have a pattern which can be matched by a regular expression, and each barcode is within a single sequencing read. It can handle barcodes with flexible length, and barcodes with UMI (unique molecular identifier).

This tool can also be used for the pre-processing part of amplicon data analysis such as CRISPR gRNA screening, immune repertoire sequencing and meta genome data.

What can the package do?

The package provides functions for 1). Sequence quality control and filtering, 2). Barcode (and UMI) extraction from sequencing reads, 3). Sample and barcode management with metadata, 4). Barcode filtering.

About function naming

Most of the functions in this packages have names with bc_ as initiation. We hope it can facilitate the syntax auto-complement function of IDE (integrated development toolkit) or IDE-like tools such as RStudio, R-NVIM (in VIM), and ESS (in Emacs). By typing bc_ you can have a list of suggested functions, then you can pick the function you need from the list.

TODO: the function brain-map

About test data set

The test data set in this package can be accessed by

system.file("extdata", "mef_test_data", package="CellBarcode")

The data are from Jos et. al (TODO: citation). There are 7 mouse embryo fibroblast (MEF) lines with different DNA barcodes. The barcodes are in vivo inducible VDJ barcodes (TODO: add citation when have). These MEF lines were mixed in a ratio of 1:2:4:8:16:32:64.

sequence clone size 2^x
AAGTCCAGTTCTACTATCGTAGCTACTA 1
AAGTCCAGTATCGTTACGCTACTA 2
AAGTCCAGTCTACTATCGTTACGACAGCTACTA 3
AAGTCCAGTTCTACTATCGTTACGAGCTACTA 4
AAGTCCATCGTAGCTACTA 5
AAGTCCAGTACTGTAGCTACTA 6
AAGTCCAGTACTATCGTACTA 7

Then 5 pools of 196 to 50000 cells were prepared from the MEF lines mixture. For each pool 2 technical replicates (NGS libraries) were prepared and sequenced, finally resulting in 10 samples.

sample name cell number replication
195_mixa 195 mixa
195_mixb 195 mixb
781_mixa 781 mixa
781_mixb 781 mixb
3125_mixa 3125 mixa
3125_mixb 3125 mixb
12500_mixa 12500 mixa
12500_mixb 12500 mixb
50000_mixa 50000 mixa
50000_mixb 50000 mixb

The original FASTQ files are relatively large, so only 2000 reads for each sample have been randomly sampled as a test set here.

example_data <- system.file("extdata", "mef_test_data", package = "CellBarcode")
fq_files <- dir(example_data, "fastq.gz", full=TRUE)

# prepare metadata for the samples
metadata <- stringr::str_split_fixed(basename(fq_files), "_", 10)[, c(4, 6)]
metadata <- as.data.frame(metadata)
sample_name <- apply(metadata, 1, paste, collapse = "_")
colnames(metadata) = c("cell_number", "replication")
# metadata should has the row names consistent to the sample names
rownames(metadata) = sample_name
metadata
#>            cell_number replication
#> 50000_mixa       50000        mixa
#> 195_mixb           195        mixb
#> 50000_mixb       50000        mixb
#> 12500_mixa       12500        mixa
#> 12500_mixb       12500        mixb
#> 3125_mixa         3125        mixa
#> 3125_mixb         3125        mixb
#> 781_mixa           781        mixa
#> 781_mixb           781        mixb
#> 195_mixa           195        mixa

Installation

Install from Bioconductor.

if(!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")
BiocManager::install("CellBarcode")

Install the development version from Github.

# install.packages("remotes")
remotes::install_github("wenjie1991/CellBarcode")

A basic workflow

Here is an example of a basic workflow:

# install.packages("stringr")
library(CellBarcode)
library(magrittr)

# The example data is the mix of MEF lines with known barcodes
# 2000 reads for each file have been sampled for this test dataset
# extract UMI barcode with regular expression
bc_obj <- bc_extract(
  fq_files,  # fastq file
  pattern = "([ACGT]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT", 
  pattern_type = c("UMI" = 1, "barcode" = 2),
  sample_name = sample_name,
  metadata = metadata
)
bc_obj
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> cell_number  replication  raw_read_count  barcode_read_count
#> ----------
#> @messyBc: 10 sample(s) for raw barcodes:
#>     In sample $50000_mixa there are: 1310 Tags
#>     In sample $195_mixb there are: 1318 Tags
#>     In sample $50000_mixb there are: 1385 Tags
#>     In sample $12500_mixa there are: 1321 Tags
#>     In sample $12500_mixb there are: 1361 Tags
#>     In sample $3125_mixa there are: 1287 Tags
#>     In sample $3125_mixb there are: 1297 Tags
#>     In sample $781_mixa there are: 1295 Tags
#>     In sample $781_mixb there are: 1303 Tags
#>     In sample $195_mixa there are: 1343 Tags

# sample subset operation, select technical repeats 'mixa'
bc_sub = bc_subset(bc_obj, sample=replication == "mixa")
bc_sub 
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> cell_number  replication  raw_read_count  barcode_read_count
#> ----------
#> @messyBc: 5 sample(s) for raw barcodes:
#>     In sample $50000_mixa there are: 1310 Tags
#>     In sample $12500_mixa there are: 1321 Tags
#>     In sample $3125_mixa there are: 1287 Tags
#>     In sample $781_mixa there are: 1295 Tags
#>     In sample $195_mixa there are: 1343 Tags

# filter the barcode, UMI barcode amplicon >= 2 & UMI counts >= 2
bc_sub <- bc_cure_umi(bc_sub, depth = 2) %>% bc_cure_depth(depth = 2)

# select barcodes with a white list
bc_2df(bc_sub)
#>    sample_name                      barcode_seq count
#> 1   50000_mixa         AAGTCCAGTATCGTTACGCTACTA    10
#> 2   50000_mixa           AAGTCCAGTACTGTAGCTACTA    11
#> 3   50000_mixa              AAGTCCATCGTAGCTACTA     3
#> 4   12500_mixa         AAGTCCAGTATCGTTACGCTACTA    20
#> 5   12500_mixa           AAGTCCAGTACTGTAGCTACTA    11
#> 6   12500_mixa              AAGTCCATCGTAGCTACTA     4
#> 7   12500_mixa AAGTCCAGTTCTACTATCGTTACGAGCTACTA     3
#> 8    3125_mixa              AAGTCCATCGTAGCTACTA     7
#> 9    3125_mixa         AAGTCCAGTATCGTTACGCTACTA    17
#> 10   3125_mixa           AAGTCCAGTACTGTAGCTACTA     9
#> 11   3125_mixa AAGTCCAGTTCTACTATCGTTACGAGCTACTA     7
#> 12    781_mixa         AAGTCCAGTATCGTTACGCTACTA     7
#> 13    781_mixa           AAGTCCAGTACTGTAGCTACTA     9
#> 14    781_mixa              AAGTCCATCGTAGCTACTA     2
#> 15    195_mixa              AAGTCCATCGTAGCTACTA     9
#> 16    195_mixa           AAGTCCAGTACTGTAGCTACTA    11
#> 17    195_mixa         AAGTCCAGTATCGTTACGCTACTA    12
#> 18    195_mixa            AAGTCCAGTACTATCGTACTA     2
#> 19    195_mixa AAGTCCAGTTCTACTATCGTTACGAGCTACTA     4
bc_sub[c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"), ]
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 5 field(s) available:
#> cell_number  replication  raw_read_count  barcode_read_count  depth_cutoff
#> ----------
#> @messyBc: 5 sample(s) for raw barcodes:
#>     In sample $50000_mixa there are: 434 Tags
#>     In sample $12500_mixa there are: 490 Tags
#>     In sample $3125_mixa there are: 455 Tags
#>     In sample $781_mixa there are: 524 Tags
#>     In sample $195_mixa there are: 484 Tags
#> ----------
#> @cleanBc: 5 samples for cleaned barcodes
#>     In sample $50000_mixa there are: 1 barcodes
#>     In sample $12500_mixa there are: 1 barcodes
#>     In sample $3125_mixa there are: 1 barcodes
#>     In sample $781_mixa there are: 1 barcodes
#>     In sample $195_mixa there are: 2 barcodes

# export the barcode counts to data.frame
head(bc_2df(bc_sub))
#>   sample_name              barcode_seq count
#> 1  50000_mixa AAGTCCAGTATCGTTACGCTACTA    10
#> 2  50000_mixa   AAGTCCAGTACTGTAGCTACTA    11
#> 3  50000_mixa      AAGTCCATCGTAGCTACTA     3
#> 4  12500_mixa AAGTCCAGTATCGTTACGCTACTA    20
#> 5  12500_mixa   AAGTCCAGTACTGTAGCTACTA    11
#> 6  12500_mixa      AAGTCCATCGTAGCTACTA     4

# export the barcode counts to matrix
head(bc_2matrix(bc_sub))
#>                                  X12500_mixa X195_mixa X3125_mixa X50000_mixa
#> AAGTCCAGTACTATCGTACTA                      0         2          0           0
#> AAGTCCAGTACTGTAGCTACTA                    11        11          9          11
#> AAGTCCAGTATCGTTACGCTACTA                  20        12         17          10
#> AAGTCCAGTTCTACTATCGTTACGAGCTACTA           3         4          7           0
#> AAGTCCATCGTAGCTACTA                        4         9          7           3
#>                                  X781_mixa
#> AAGTCCAGTACTATCGTACTA                    0
#> AAGTCCAGTACTGTAGCTACTA                   9
#> AAGTCCAGTATCGTTACGCTACTA                 7
#> AAGTCCAGTTCTACTATCGTTACGAGCTACTA         0
#> AAGTCCATCGTAGCTACTA                      2

Sequence quality control

Evaluation

In a full analysis starting from fastq files, the first step is to check the seqencing quality and filter as required. The bc_seq_qc function is for checking the sequencing quality. If multiple samples are input the output is a BarcodeQcSet object, otherwise a BarcodeQC object will be returned. In addition, bc_seq_qc also can handle the ShortReadQ, DNAStringSet and other data types.

qc_noFilter <- bc_seq_qc(fq_files)
qc_noFilter
#> The sequence QC set, use `[]` to select sample:
#>      5290_1_BCM_50000_mef_mixa_GTTCTCC_S2_R1_001.fastq.gz
#>      5290_10_BCM_195_mef_mixb_GTCATTG_S11_R1_001.fastq.gz
#>      5290_2_BCM_50000_mef_mixb_GATGTGT_S5_R1_001.fastq.gz
#>      5290_3_BCM_12500_mef_mixa_TGCCTTG_S4_R1_001.fastq.gz
#>      5290_4_BCM_12500_mef_mixb_TAACTGC_S8_R1_001.fastq.gz
#>      5290_5_BCM_3125_mef_mixa_GCTTCCA_S9_R1_001.fastq.gz
#>      5290_6_BCM_3125_mef_mixb_TGTGAGT_S7_R1_001.fastq.gz
#>      5290_7_BCM_781_mef_mixa_CCTTACC_S12_R1_001.fastq.gz
#>      5290_8_BCM_781_mef_mixb_CGTATCC_S13_R1_001.fastq.gz
#>      5290_9_BCM_195_mef_mixa_GTACTGT_S14_R1_001.fastq.gz
bc_names(qc_noFilter)
#>  [1] "5290_1_BCM_50000_mef_mixa_GTTCTCC_S2_R1_001.fastq.gz"
#>  [2] "5290_10_BCM_195_mef_mixb_GTCATTG_S11_R1_001.fastq.gz"
#>  [3] "5290_2_BCM_50000_mef_mixb_GATGTGT_S5_R1_001.fastq.gz"
#>  [4] "5290_3_BCM_12500_mef_mixa_TGCCTTG_S4_R1_001.fastq.gz"
#>  [5] "5290_4_BCM_12500_mef_mixb_TAACTGC_S8_R1_001.fastq.gz"
#>  [6] "5290_5_BCM_3125_mef_mixa_GCTTCCA_S9_R1_001.fastq.gz" 
#>  [7] "5290_6_BCM_3125_mef_mixb_TGTGAGT_S7_R1_001.fastq.gz" 
#>  [8] "5290_7_BCM_781_mef_mixa_CCTTACC_S12_R1_001.fastq.gz" 
#>  [9] "5290_8_BCM_781_mef_mixb_CGTATCC_S13_R1_001.fastq.gz" 
#> [10] "5290_9_BCM_195_mef_mixa_GTACTGT_S14_R1_001.fastq.gz"
class(qc_noFilter)
#> [1] "BarcodeQcSet"
#> attr(,"package")
#> [1] "CellBarcode"

The bc_plot_seqQc function can be invoked with a BarcodeQcSet as argument, and the output is a QC summary with two panels. The first shows the ratio of ATCG bases for each sequencing cycle with one sample per row; this allows the user to, for example, identify constant or random parts of the sequencing read. The second figure shows the average sequencing quality index of each cycle (base).

For the test set, the first 12 bases are UMI, which are random. This is followed by the constant region of the barcode (the PCR primer selects reads with this sequence), and here we observe a specific base for each cycle across all the samples.

bc_plot_seqQc(qc_noFilter) 

We can also plot one of the BarcodeQc in the BarcodeQcSet object. In the output, there are three panels. The top left one shows the reads depth distribution, the top right figure shows the “ATCG” base ratio by each sequencing cycle, and the last one shows the sequencing quality by sequencing cycle.

qc_noFilter[1]
#> Sequnece QC, summary:
#>      total_read: 2000
#>      p5_read_length: 100
#>      median_read_length: 100
#>      p95_read_length: 100
class(qc_noFilter[1])
#> [1] "BarcodeQc"
#> attr(,"package")
#> [1] "CellBarcode"
bc_plot_seqQc(qc_noFilter[1]) 

Filtering

bc_seq_filter reads in the sequence data and applies filters, then returns a ShortReadQ object which contains the filtered sequences.

The bc_seq_filter function can read fastq files, and it can also handle sequencing reads in ShortReadQ, DNAStringSet and data.frame.

The currently available filter parameters are: - min_average_quality: average base sequencing quality across read. - min_read_length: minimum number of bases per read. - N_threshold: maximum number of “N” bases in sequence.

# TODO: output the filtering percentage
# TODO: Trimming
fq_filter <- bc_seq_filter(
  fq_files,
  min_average_quality = 30,
  min_read_length = 60,
  sample_name = sample_name)

fq_filter
#> $`50000_mixa`
#> class: ShortReadQ
#> length: 1154 reads; width: 100 cycles
#> 
#> $`195_mixb`
#> class: ShortReadQ
#> length: 1187 reads; width: 100 cycles
#> 
#> $`50000_mixb`
#> class: ShortReadQ
#> length: 1234 reads; width: 100 cycles
#> 
#> $`12500_mixa`
#> class: ShortReadQ
#> length: 1186 reads; width: 100 cycles
#> 
#> $`12500_mixb`
#> class: ShortReadQ
#> length: 1238 reads; width: 100 cycles
#> 
#> $`3125_mixa`
#> class: ShortReadQ
#> length: 1100 reads; width: 100 cycles
#> 
#> $`3125_mixb`
#> class: ShortReadQ
#> length: 1146 reads; width: 100 cycles
#> 
#> $`781_mixa`
#> class: ShortReadQ
#> length: 1154 reads; width: 100 cycles
#> 
#> $`781_mixb`
#> class: ShortReadQ
#> length: 1164 reads; width: 100 cycles
#> 
#> $`195_mixa`
#> class: ShortReadQ
#> length: 1205 reads; width: 100 cycles
bc_plot_seqQc(bc_seq_qc(fq_filter))

Parse reads

One of the core applications of this package is parsing the sequences to get the barcode (and UMI). Our package uses regular expressions to identify barcodes (and UMI) from sequencing reads. This is how we tell bc_extract the structure of the input sequences.

3 arguments are necessary for bc_extract, they are: - x: the sequence data, it can be in fastq, ShortReadQ, DNAStringSet or data.frame format. - pattern: the sequence pattern regular expression. - pattern_type: pattern description.

The pattern argument is the regular expression, it tells the function where to find the barcode (or UMI). We capture the barcode (or UMI) by () in the backbone. For the sequence captured by (), the pattern_type argument tells which is the UMI or the barcode. In the example

pattern <- "([ACGA]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
pattern_type <- c("UMI" = 1, "barcode" = 2)
  1. The sequence starts with 12 base pairs of random sequence, which is UMI. It is the first barcode captured by () in the pattern argument, and corresponds to UMI = 1 in the pattern_type argument.
  2. Then, there is a known constant sequence: CTCGAGGTCATCGAAGTATC.
  3. Following the constant region, there is flexible length random sequence. This is the barcode which is trapped by second (), and it is defined by barcode = 2 in the pattern_type argument.
  4. At the end of the sequence, there is another constant sequence CCGTAGCAAGCTCGAGAGTAGACCTACT.

In the regular expression, the UMI pattern is retrieved with [ACGT]{12}. The [ACGT] means to match “A”, “C”, “G” or “T”, and the {12} means match 12 [ACGT]. In the barcode pattern [ACGT]+, again [ACGT] means match “A”, “C”, “G” or “T” and the + says to match at least one [ACGT].

The bc_extract function is used to extract the barcode(s) from the sequences. It returns a BarcodeObj object if the input is a list or a vector of Fastq files. The BarcodeObj created by bc_extract is a R S4 class with three slots: messyBc, metadata and cleanBc (which is NULL in the bc_extract output). They can be accessed by @ operator or corresponding accesors: - bc_messyBc: return the messyBc slot. - bc_cleanBc: return the cleanBc slot. - bc_meta: return the metadata slot.

messyBc is a list, where each element is a data.table corresponding to the successive samples. Each data.table has 3 columns:

  1. umi_seq (optional): UMI sequence, applicable when there is a UMI in pattern and pattern_type argument.
  2. barcode_seq: barcode sequence.
  3. count: the count of the full read sequence.

Attention: In the data.table, barcode_seq value may be not unique, as two different full read sequences can contain the same barcode sequence, due to the UMI or mutations in the constant region.

If the input to bc_extract is just a sample, the output is a single data.frame with the 3 columns 1). umi_seq, 2). barcode_seq and 3). count, as described above.

The sequence in match_seq is a contiguous segment of the full read given in reads_seq. The umi_seq and barcode_seq are contiguous segments of match_seq. Take note that, the reads_seq is the unique id for each row. The match_seq, umi_seq or barcode_seq can be duplicated, due to the potential variation in the region outside of match_seq. Please keep this in mind when you use data in $messyBc to perform the analysis.

Sequencing without UMI

In the following example, only a barcode is extracted.

pattern <- "CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
bc_obj <- bc_extract(
  fq_filter,
  sample_name = sample_name,
  pattern = pattern,
  pattern_type = c(barcode = 1))

bc_obj
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 2 field(s) available:
#> raw_read_count  barcode_read_count
#> ----------
#> @messyBc: 10 sample(s) for raw barcodes:
#>     In sample $50000_mixa there are: 39 Tags
#>     In sample $195_mixb there are: 31 Tags
#>     In sample $50000_mixb there are: 49 Tags
#>     In sample $12500_mixa there are: 37 Tags
#>     In sample $12500_mixb there are: 44 Tags
#>     In sample $3125_mixa there are: 36 Tags
#>     In sample $3125_mixb there are: 44 Tags
#>     In sample $781_mixa there are: 34 Tags
#>     In sample $781_mixb there are: 29 Tags
#>     In sample $195_mixa there are: 34 Tags
names(bc_messyBc(bc_obj)[[1]])
#> [1] "barcode_seq" "count"

Here the regular expression matches a constant sequence at the beginning and the end and the barcode in () matches at least one of any character.

Sequencing with UMI

In the following example, both UMI and barcode are extracted. The regular expression is explained above.

pattern <- "([ACGA]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
bc_obj_umi <- bc_extract(
  fq_filter,
  sample_name = sample_name,
  pattern = pattern,
  maxLDist = 0,
  pattern_type = c(UMI = 1, barcode = 2))

class(bc_obj_umi)
#> [1] "BarcodeObj"
#> attr(,"package")
#> [1] "CellBarcode"
bc_obj_umi
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 2 field(s) available:
#> raw_read_count  barcode_read_count
#> ----------
#> @messyBc: 10 sample(s) for raw barcodes:
#>     In sample $50000_mixa there are: 142 Tags
#>     In sample $195_mixb there are: 127 Tags
#>     In sample $50000_mixb there are: 143 Tags
#>     In sample $12500_mixa there are: 106 Tags
#>     In sample $12500_mixb there are: 134 Tags
#>     In sample $3125_mixa there are: 106 Tags
#>     In sample $3125_mixb there are: 120 Tags
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#>     In sample $195_mixa there are: 154 Tags

Metadata updated

bc_extract added two columns named “row_read_count” and “barcode_read_count” to the metadata slot of the returned BarcodeObj object.

row_read_count: Total raw reads number of each sample. barcode_read_count: The number of reads that contain the barcodes.

You can use the ratio of barcode_read_count versus raw_read_count to check the successfulness of the sequencing or correctness of the pattern given to the bc_extract.

# select two samples from bc_obj_umi
bc_obj_umi_sub <- bc_obj_umi[, c("781_mixa", "781_mixb")]
# get the metadata matrix
(d <- bc_meta(bc_obj_umi_sub))
#>          raw_read_count barcode_read_count
#> 781_mixa           1154                134
#> 781_mixb           1164                112
# use the row name of the metadata, which contains the sample names
d$sample_name <- rownames(d)

d$barcode_read_count / d$raw_read_count
#> [1] 0.11611785 0.09621993
# visualize
ggplot(d) + 
    aes(x=sample_name, y=barcode_read_count / raw_read_count) + 
    geom_bar(stat="identity")

Data management

Besides, we provide operators to handle the barcodes and samples in BarcodeObj object. You can easily select one or several samples by their names, indices or metadata.

Select slot by accesors:

# Access messyBc slot
head(bc_messyBc(bc_obj_umi)[[1]], n=2)
#>        umi_seq              barcode_seq count
#> 1 GGACAGAGCGGA AAGTCCAGTATCGTTACGCTACTA     2
#> 2 GGCCGGCGGGGC   AAGTCCAGTACTGTAGCTACTA     2
# return a data.frame
head(bc_messyBc(bc_obj_umi, isList=FALSE), n=2)
#>    sample_name      umi_seq              barcode_seq count
#>         <char>       <char>                   <char> <int>
#> 1:  50000_mixa GGACAGAGCGGA AAGTCCAGTATCGTTACGCTACTA     2
#> 2:  50000_mixa GGCCGGCGGGGC   AAGTCCAGTACTGTAGCTACTA     2

# Access cleanBc slot
# return a data.frame
head(bc_cleanBc(bc_obj_umi, isList=FALSE), n=2)
#>    sample_nmae      umi_seq              barcode_seq count
#>         <char>       <char>                   <char> <int>
#> 1:  50000_mixa GGACAGAGCGGA AAGTCCAGTATCGTTACGCTACTA     2
#> 2:  50000_mixa GGCCGGCGGGGC   AAGTCCAGTACTGTAGCTACTA     2

Select sample by sample names

bc_obj_umi_sub <- bc_obj_umi[, c("781_mixa", "781_mixb")]
bc_names(bc_obj_umi_sub)
#> [1] "781_mixa" "781_mixb"

Set metadata

bc_meta(bc_obj_umi_sub)$rep <- c("a", "b")
bc_meta(bc_obj_umi_sub)
#>          raw_read_count barcode_read_count rep
#> 781_mixa           1154                134   a
#> 781_mixb           1164                112   b

Select sample by metadata

bc_subset(bc_obj_umi_sub, sample = rep == "a")
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 3 field(s) available:
#> raw_read_count  barcode_read_count  rep
#> ----------
#> @messyBc: 1 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags

Barcode filtering

Most of the times, it needs PCR and NGS to read out the cellular barcode sequences. bc_extract will output all barcodes found in the sequences. Some of the identified barcodes may contain PCR or sequencing errors.

The potential errors derived from PCR and NGS lead to spurious barcodes that not existed in biological samples. The spurious barcodes are more likely to be less abundant comparing to corresponding “mother” barcodes they derived from.

As UMI can be used to label a DNA molecular, one UMI labeled barcode molecular becomes multiple copies by PCR. Thus all the sequences derived from the template sequence, including original template sequence and mutant ones, are marked by UMI for having the same UMI. The original template sequence is likely having more reads comparing to the spurious one derived from PCR or sequencing mutation, as errors happens with low probability. Also, a barcode sequence is less likely to be spurious one when it relates to several UMIs.

We created the bc_cure_* functions to perform filtering for removing the potential spurious barcodes. The bc_cure_* functions create or update the cleanBc slot in BarcodeObj. The cleanBc slot contains 2 columns - barcode_seq: barcode sequence. - counts: reads count, or UMI count in the case that the cleanBc was created by bc_cure_umi.

Important: The createBc slot, the barcode_seq is not duplicated in each sample.

In the bc_cure_* function family, there are bc_cure_depth, bc_cure_umi and bc_cure_cluster.

Filter UMI-barcode tag

In the case when the UMI is applied, the template sequence is marked by UMI, and we use “UMI-barcode tag” to denote a combination of a UMI and a barcode. The UMI-barcode tag with few reads are likely deriving from PCR or sequence errors. bc_cure_umi carries out the filtering based on the UMI-barcode tag read count from the messyBc slot in BarcodeObj object, and returns a updated BarcodeObj object with a cleanBc slot containing the barcodes passing the filtering.

# Filter the barcodes with UMI-barcode tag >= 1, 
# and treat UMI as absolute unique and do "fish"
bc_obj_umi_sub <- bc_cure_umi(
    bc_obj_umi_sub, depth = 1, 
    isUniqueUMI = TRUE, 
    doFish = TRUE)
bc_obj_umi_sub
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 3 field(s) available:
#> raw_read_count  barcode_read_count  rep
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $781_mixa there are: 9 barcodes
#>     In sample $781_mixb there are: 8 barcodes

The available arguments of bc_cure_umi are:

  • depth: minimum read count required for a UMI.
  • doFish: if true, for barcodes with UMI read depth above the threshold, “fish” for identical barcodes with UMI read depth below the threshold. The consequence of “doFish” will not increase the number of identified barcodes, but the UMI counts will increase due to including the low depth UMI barcodes.
  • isUniqueUMI: one UMI sequence may be linked to several barcodes. Do you believe the UMI is absolutely unique? If yes, we treat the UMI as absolutely unique makers. Thus the most abundant barcode will be picked for a UMI, and less abundant barcodes with the same UMI are obsolete.

Filter by count

bc_cure_depth performs filtering by reads/UMI count. It can filter the raw barcodes in the messyBc and create a cleanBc slot , or update the cleanBc when the argument isUpdate is TRUE. You should set this argument to TRUE, when you want apply the filtering on the UMI count with the bc_cure_umi output. In this case, bc_cure_depth will update the cleanBc slot created by bc_cure_umi.

The function has two arguments:

  • depth: sequence/UMI count threshold, it can be a numeric number or a numeric vector, in the later case, each number corresponds to a sample in the BarcodeObj object.
  • isUpdate: if true (default) the bc_cure will preferentially perform filtering on the cleanBc slot and update it, otherwise the messyBc will be used as input.
# Apply the barcode sequence depth with depth >= 3
# With isUpdate = FLASE, the data in `messyBc` slot of bc_obj_umi_sub
#   will be used for depth filtering. The UMI information will be discarded, 
#   the identical barcodes in different UMI-barcode tags are merged before
#   performing the sequence depth filtering.
bc_obj_umi_sub <- bc_cure_depth(bc_obj_umi_sub, depth = 3, isUpdate = FALSE)
bc_obj_umi_sub
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> raw_read_count  barcode_read_count  rep  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $781_mixa there are: 5 barcodes
#>     In sample $781_mixb there are: 4 barcodes

# Apply the UMI count filter, keep barcode >= 3 UMI
# The `bc_cure_umi` function applies the filtering on the UMI-barcode tags,
#   and create a `cleanBc` slot in the return BarcodeObj object. Then, 
#   the `bc_cure_depth` with `isUpdate` argument TRUE will apply the filtering
#   on the UMI counts in `cleanBc` and updated the `cleanBc`.
bc_obj_umi_sub <- bc_cure_umi(
    bc_obj_umi_sub, depth = 1, 
    isUniqueUMI = TRUE, 
    doFish = TRUE)
bc_obj_umi_sub
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> raw_read_count  barcode_read_count  rep  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $781_mixa there are: 9 barcodes
#>     In sample $781_mixb there are: 8 barcodes
bc_obj_umi_sub <- bc_cure_depth(bc_obj_umi_sub, depth = 3, isUpdate = TRUE)
bc_obj_umi_sub
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> raw_read_count  barcode_read_count  rep  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $781_mixa there are: 5 barcodes
#>     In sample $781_mixb there are: 4 barcodes

Cluster barcode by sequence similarity

The sequences with more reads have more chance to be the original templates. In contrast,the sequences with few reads are more likely derived from mutations of the most abundant sequence. Thus, the spurious sequence might be identified by comparing the most abundant sequence to the least one. If they are similar, the least abundant sequence will be removed.

bc_cure_cluster performs the clustering to remove the barcodes with insufficient depth (or UMI counts) comparing to most abundant ones with similarity, it needs the cleanBc slot and will update it.

To control the clustering methods and threshold for merging you need the following arguments:

  • dist_thresh: a single integer or vector of integers with the length of sample number, specifying the editing distance threshold of merging two similar barcode sequences. If the input is a vector, each value in vector is for one sample according to the sample order in BarcodeObj object.
  • dist_method: A character string, specifying the distance algorithm for evaluating barcodes similarity. It can be “hamm” for Hamming distance or “leven” for Levenshtein distance.
  • cluster_method: A character string specifying the algorithm used to perform the clustering merging of barcodes. Currently only “greedy” is available, in this case, the least abundant barcode is removed.
  • param count_threshold: An integer, read depth threshold to consider a barcode as a true barcode, when when a barcode with count higher than this threshold it will not be removed.
  • dist_costs: A list, the cost of the events when calculating distance between two barcode sequences, applicable when Levenshtein distance is applied. The names of vector have to be “insert”, “delete” and “replace”, specifying the weight of insertion, deletion, replacement events respectively. The default cost for each event is 1.
# Do the clustering and merging the least abundant barcodes to the similar
# abundant ones
bc_cure_cluster(bc_obj_umi_sub)
#> [[1]]
#>                        barcode_seq count
#> 1         AAGTCCAGTATCGTTACGCTACTA    53
#> 5           AAGTCCAGTACTGTAGCTACTA    50
#> 4              AAGTCCATCGTAGCTACTA    13
#> 3            AAGTCCAGTACTATCGTACTA     6
#> 2 AAGTCCAGTTCTACTATCGTTACGAGCTACTA     4
#> 
#> [[2]]
#>                        barcode_seq count
#> 1         AAGTCCAGTATCGTTACGCTACTA    43
#> 4           AAGTCCAGTACTGTAGCTACTA    37
#> 3              AAGTCCATCGTAGCTACTA    20
#> 2 AAGTCCAGTTCTACTATCGTTACGAGCTACTA     7
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 4 field(s) available:
#> raw_read_count  barcode_read_count  rep  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $781_mixa there are: 131 Tags
#>     In sample $781_mixb there are: 112 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $781_mixa there are: 5 barcodes
#>     In sample $781_mixb there are: 4 barcodes

Barcode count distribution

We provides bc_plot_single, bc_plot_mutual and bc_plot_pair functions for helping exploring the barcode count distribution for single sample or between two samples.

Single sample

bc_plot_single can be used for exploring barcode count distribution sample wise. It uses the cleanBc slot in the BarcodeObj bc_obj_umi_sub.

bc_plot_single(bc_obj_umi_sub)

The bc_plot_single function provides arguments for showing the potential cutoff point and highlighting specific barcodes.

# re-do the filtering using depth threshold 0 to include all barcodes.
bc_obj_umi_sub_neo <- bc_cure_depth(bc_obj_umi_sub, depth=0, isUpdate=FALSE)

# you can use the count_marks argument to display the cutoff points in the figure
# and the highlight argument to highlight specific barcodes.
bc_plot_single(bc_obj_umi_sub_neo, count_marks=10, 
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"))

Pairwise

bc_plot_mutual and bc_plot_pair are designed for comparing the barcodes between two samples.

The bc_plot_mutual generates a scatter plot matrix which contains all the pairwise sample combination in the provided BarcodeObj object.

# create a new BarcodeObj for following visualization
# use depth as 0 to include all the barcodes.
bc_obj_umi_neo <- bc_cure_depth(bc_obj_umi[, 1:4], depth=0)
# you can set the count_marks to display the cutoff point
# and highlight specific barcodes dots by highlight
bc_plot_mutual(bc_obj_umi_neo, count_marks=c(10, 20, 30, 40), 
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"))
#> Warning: `aes_string()` was deprecated in ggplot2 3.0.0.
#> ℹ Please use tidy evaluation idioms with `aes()`.
#> ℹ See also `vignette("ggplot2-in-packages")` for more information.
#> ℹ The deprecated feature was likely used in the CellBarcode package.
#>   Please report the issue at
#>   <https://github.com/wenjie1991/CellBarcode/issues>.
#> This warning is displayed once per session.
#> Call `lifecycle::last_lifecycle_warnings()` to see where this warning was
#> generated.

And the bc_plot_pair only draws the scatter plot for the given sample pairs.

# create a new BarcodeObj for following visualization
# use depth as 0 to include all the barcodes.
bc_obj_umi_neo <- bc_cure_depth(bc_obj_umi[, 1:4], depth=0)

# 2d scatters plot with x axis of sample_x and y axis of sample_y
# sample_x, and sample_y can be the sample name or sample index
bc_plot_pair(
    bc_obj_umi_neo, 
    sample_x = c("50000_mixa"),
    sample_y = c("50000_mixb", "12500_mixa", "195_mixb"), 
    count_marks_x = 10,
    count_marks_y = c(10, 20, 30),
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA")
)

Miscellaneous

We provides functions to transform the barcode information in BarcodeObj to more general R data types.

Sample names

bc_names(bc_obj_umi_sub)
#> [1] "781_mixa" "781_mixb"

Output to data.frame

bc_2df function uses the barcode and count info in the cleanBc slot, outputs a data.frame contains: - barcode_seq: barcode sequence - sample_name - count: reads or UMI count

bc_2df(bc_obj_umi_sub)
#>   sample_name                      barcode_seq count
#> 1    781_mixa         AAGTCCAGTATCGTTACGCTACTA    53
#> 2    781_mixa           AAGTCCAGTACTGTAGCTACTA    50
#> 3    781_mixa            AAGTCCAGTACTATCGTACTA     6
#> 4    781_mixa              AAGTCCATCGTAGCTACTA    13
#> 5    781_mixa AAGTCCAGTTCTACTATCGTTACGAGCTACTA     4
#> 6    781_mixb           AAGTCCAGTACTGTAGCTACTA    37
#> 7    781_mixb         AAGTCCAGTATCGTTACGCTACTA    43
#> 8    781_mixb              AAGTCCATCGTAGCTACTA    20
#> 9    781_mixb AAGTCCAGTTCTACTATCGTTACGAGCTACTA     7

Or if you prefer data.table

bc_2dt(bc_obj_umi_sub)
#>    sample_name                      barcode_seq count
#>         <char>                           <char> <int>
#> 1:    781_mixa         AAGTCCAGTATCGTTACGCTACTA    53
#> 2:    781_mixa           AAGTCCAGTACTGTAGCTACTA    50
#> 3:    781_mixa            AAGTCCAGTACTATCGTACTA     6
#> 4:    781_mixa              AAGTCCATCGTAGCTACTA    13
#> 5:    781_mixa AAGTCCAGTTCTACTATCGTTACGAGCTACTA     4
#> 6:    781_mixb           AAGTCCAGTACTGTAGCTACTA    37
#> 7:    781_mixb         AAGTCCAGTATCGTTACGCTACTA    43
#> 8:    781_mixb              AAGTCCATCGTAGCTACTA    20
#> 9:    781_mixb AAGTCCAGTTCTACTATCGTTACGAGCTACTA     7

Output to matrix

bc_2matrix uses barcode and count information in cleanBc slot to create reads count or UMI count matrix, with barcodes in rows and samples in columns.

bc_2matrix(bc_obj_umi_sub)
#>                                  X781_mixa X781_mixb
#> AAGTCCAGTACTATCGTACTA                    6         0
#> AAGTCCAGTACTGTAGCTACTA                  50        37
#> AAGTCCAGTATCGTTACGCTACTA                53        43
#> AAGTCCAGTTCTACTATCGTTACGAGCTACTA         4         7
#> AAGTCCATCGTAGCTACTA                     13        20

More

You can use:

  • +: to combine two BarcodeObj objects.
  • -: to remove barcodes in a black list.
  • *: only include barcodes in a white list.

For examples:

data(bc_obj)

# Join two samples with different barcodes 
bc_obj["AGAG", "test1"] + bc_obj["AAAG", "test1"]
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 6 field(s) available:
#> raw_read_count.bc_obj["AGAG", "test1"]  barcode_read_count.bc_obj["AGAG", "test1"]  depth_cutoff.bc_obj["AGAG", "test1"]  raw_read_count.bc_obj["AAAG", "test1"]  barcode_read_count.bc_obj["AAAG", "test1"]  depth_cutoff.bc_obj["AAAG", "test1"]
#> ----------
#> @messyBc: 1 sample(s) for raw barcodes:
#>     In sample $test1 there are: 6 Tags
#> ----------
#> @cleanBc: 1 samples for cleaned barcodes
#>     In sample $test1 there are: 2 barcodes

# Join two samples with shared barcodes
bc_obj_join <- bc_obj["AGAG", "test1"] + bc_obj["AGAG", "test1"]
#> Warning in merge.data.frame(metadata_x, metadata_y, by = 0, all = TRUE, :
#> column names 'raw_read_count.bc_obj["AGAG", "test1"]',
#> 'barcode_read_count.bc_obj["AGAG", "test1"]', 'depth_cutoff.bc_obj["AGAG",
#> "test1"]' are duplicated in the result
bc_obj_join
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 6 field(s) available:
#> raw_read_count.bc_obj["AGAG", "test1"]  barcode_read_count.bc_obj["AGAG", "test1"]  depth_cutoff.bc_obj["AGAG", "test1"]  raw_read_count.bc_obj["AGAG", "test1"]  barcode_read_count.bc_obj["AGAG", "test1"]  depth_cutoff.bc_obj["AGAG", "test1"]
#> ----------
#> @messyBc: 1 sample(s) for raw barcodes:
#>     In sample $test1 there are: 3 Tags
#> ----------
#> @cleanBc: 1 samples for cleaned barcodes
#>     In sample $test1 there are: 1 barcodes

# In this case, the shared barcodes are not merged.
# Applying bc_cure_depth() to merge them.
bc_cure_depth(bc_obj_join)
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 7 field(s) available:
#> raw_read_count.bc_obj["AGAG", "test1"]  barcode_read_count.bc_obj["AGAG", "test1"]  depth_cutoff.bc_obj["AGAG", "test1"]  raw_read_count.bc_obj["AGAG", "test1"].1  barcode_read_count.bc_obj["AGAG", "test1"].1  depth_cutoff.bc_obj["AGAG", "test1"].1  depth_cutoff
#> ----------
#> @messyBc: 1 sample(s) for raw barcodes:
#>     In sample $test1 there are: 3 Tags
#> ----------
#> @cleanBc: 1 samples for cleaned barcodes
#>     In sample $test1 there are: 1 barcodes

# Remove barcodes
bc_obj - "AAAG"
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 3 field(s) available:
#> raw_read_count  barcode_read_count  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $test1 there are: 7 Tags
#>     In sample $test2 there are: 7 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $test1 there are: 3 barcodes
#>     In sample $test2 there are: 4 barcodes

# Select barcodes in white list
bc_obj * "AAAG"
#> Bonjour le monde, This is a BarcodeObj.
#> ----------
#> It contains: 
#> ----------
#> @metadata: 3 field(s) available:
#> raw_read_count  barcode_read_count  depth_cutoff
#> ----------
#> @messyBc: 2 sample(s) for raw barcodes:
#>     In sample $test1 there are: 3 Tags
#>     In sample $test2 there are: 2 Tags
#> ----------
#> @cleanBc: 2 samples for cleaned barcodes
#>     In sample $test1 there are: 1 barcodes
#>     In sample $test2 there are: 1 barcodes

What’s more, by combining several functions, it is possible to accomplish more complex task. In the following example, a barcode from sample “781_mixa” is selected , then output the result in data.frame format.

bc_2df(bc_obj_umi_sub[bc_barcodes(bc_obj_umi_sub)[1], "781_mixa"])
#>   sample_name              barcode_seq count
#> 1    781_mixa AAGTCCAGTATCGTTACGCTACTA    53
                  ## 1. Use `bc_barcodes` to pull out all the barcodes in two
                  ##    samples, and choose the fist barcode.
       ## 2. Select the barcode got in step 1, and the sample named "781_mixa".
## 3. Convert the BarcodeObj object to a data.frame. 

Session Info

sessionInfo()
#> R version 4.6.0 (2026-04-24)
#> Platform: x86_64-pc-linux-gnu
#> Running under: Ubuntu 24.04.4 LTS
#> 
#> Matrix products: default
#> BLAS:   /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3 
#> LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so;  LAPACK version 3.12.0
#> 
#> locale:
#>  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
#>  [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    
#>  [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
#>  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
#>  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
#> [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
#> 
#> time zone: Etc/UTC
#> tzcode source: system (glibc)
#> 
#> attached base packages:
#> [1] stats     graphics  grDevices utils     datasets  methods   base     
#> 
#> other attached packages:
#> [1] magrittr_2.0.5      CellBarcode_1.18.0  ggplot2_4.0.3      
#> [4] data.table_1.18.2.1 BiocStyle_2.40.0   
#> 
#> loaded via a namespace (and not attached):
#>  [1] SummarizedExperiment_1.42.0 gtable_0.3.6               
#>  [3] xfun_0.57                   bslib_0.10.0               
#>  [5] hwriter_1.3.2.1             latticeExtra_0.6-31        
#>  [7] Biobase_2.72.0              lattice_0.22-9             
#>  [9] vctrs_0.7.3                 tools_4.6.0                
#> [11] Rdpack_2.6.6                bitops_1.0-9               
#> [13] generics_0.1.4              stats4_4.6.0               
#> [15] parallel_4.6.0              Matrix_1.7-5               
#> [17] RColorBrewer_1.1-3          S7_0.2.2                   
#> [19] S4Vectors_0.50.0            cigarillo_1.2.0            
#> [21] lifecycle_1.0.5             stringr_1.6.0              
#> [23] compiler_4.6.0              farver_2.1.2               
#> [25] deldir_2.0-4                egg_0.4.5                  
#> [27] Rsamtools_2.28.0            Biostrings_2.80.0          
#> [29] Ckmeans.1d.dp_4.3.5         Seqinfo_1.2.0              
#> [31] codetools_0.2-20            htmltools_0.5.9            
#> [33] sys_3.4.3                   buildtools_1.0.0           
#> [35] sass_0.4.10                 yaml_2.3.12                
#> [37] crayon_1.5.3                jquerylib_0.1.4            
#> [39] BiocParallel_1.46.0         DelayedArray_0.38.0        
#> [41] cachem_1.1.0                ShortRead_1.70.0           
#> [43] abind_1.4-8                 digest_0.6.39              
#> [45] stringi_1.8.7               labeling_0.4.3             
#> [47] maketools_1.3.2             fastmap_1.2.0              
#> [49] grid_4.6.0                  cli_3.6.6                  
#> [51] SparseArray_1.12.0          S4Arrays_1.12.0            
#> [53] withr_3.0.2                 scales_1.4.0               
#> [55] rmarkdown_2.31              pwalign_1.8.0              
#> [57] XVector_0.52.0              matrixStats_1.5.0          
#> [59] jpeg_0.1-11                 interp_1.1-6               
#> [61] gridExtra_2.3               png_0.1-9                  
#> [63] evaluate_1.0.5              knitr_1.51                 
#> [65] GenomicRanges_1.64.0        IRanges_2.46.0             
#> [67] rbibutils_2.4.1             rlang_1.2.0                
#> [69] Rcpp_1.1.1-1.1              glue_1.8.1                 
#> [71] BiocManager_1.30.27         BiocGenerics_0.58.0        
#> [73] jsonlite_2.0.0              plyr_1.8.9                 
#> [75] R6_2.6.1                    MatrixGenerics_1.24.0      
#> [77] GenomicAlignments_1.48.0