If you find biomformat and/or its tutorials useful, please acknowledge and cite biomformat in your publications:
Paul J. McMurdie and Joseph N Paulson (2015). biomformat: An interface package for the BIOM file format. R/Bioconductor package version 1.0.0.
phyloseq has many more utilities for interacting with this kind of data than are provided in this I/O-oriented package.
This is an R Markdown document. Markdown is a simple formatting syntax for authoring web pages. Further details on R markdown here.
The BIOM file format (canonically pronounced “biome”) is designed to be a general-use format for representing biological sample by observation contingency tables. BIOM is a recognized standard for the Earth Microbiome Project and is a Genomics Standards Consortium candidate project. Please see the biom-format home page for more details.
This demo is designed to provide an overview of the biom package to
get you started using it quickly. The biom package itself is intended to
be a utility package that will be depended-upon by other packages in the
future. It provides I/O functionality, and functions to make it easier
to with data from biom-format files. It does not (and probably should
not) provide statistical analysis functions. However, it does provide
tools to access data from BIOM format files in ways that are extremely
common in R (such as "data.frame", "matrix",
and "Matrix" classes).
Package versions at the time (Mon Mar 16 06:25:34 2026) of this build:
## [1] '1.38.3'
Here is an example importing BIOM formats of different types into R
using the read_biom function. The resulting data objects in
R are given names beginning with x.
min_dense_file = system.file("extdata", "min_dense_otu_table.biom",
package = "biomformat")
min_sparse_file = system.file("extdata", "min_sparse_otu_table.biom",
package = "biomformat")
rich_dense_file = system.file("extdata", "rich_dense_otu_table.biom",
package = "biomformat")
rich_sparse_file = system.file("extdata", "rich_sparse_otu_table.biom",
package = "biomformat")
min_dense_file = system.file("extdata", "min_dense_otu_table.biom", package = "biomformat")
rich_dense_char = system.file("extdata", "rich_dense_char.biom", package = "biomformat")
rich_sparse_char = system.file("extdata", "rich_sparse_char.biom", package = "biomformat")
x1 = read_biom(min_dense_file)
x2 = read_biom(min_sparse_file)
x3 = read_biom(rich_dense_file)
x4 = read_biom(rich_sparse_file)
x5 = read_biom(rich_dense_char)
x6 = read_biom(rich_sparse_char)
x1## biom object.
## type: OTU table
## matrix_type: dense
## 5 rows and 6 columns
It would be hard to interpret and wasteful of RAM to stream all the
data from a BIOM format file to the standard out when printed with
print or show methods. Instead, a brief
summary of the contents BIOM data is shown.
To get access to the data in a familiar form appropriate for many standard R functions, we will need to use accessor functions, also included in the biom package.
The core “observation” data is stored in either sparse or dense
matrices in the BIOM format file, and sparse matrix support is carried
through on the R side via the
Matrix package. The variables x1 and x2,
assigned above from BIOM files, have similar (but not identical) data.
They are small enough to observe directly as tables in standard output
in an R session:
## 5 x 6 Matrix of class "dgeMatrix"
## Sample1 Sample2 Sample3 Sample4 Sample5 Sample6
## GG_OTU_1 0 0 1 0 0 0
## GG_OTU_2 5 1 0 2 3 1
## GG_OTU_3 0 0 1 4 2 0
## GG_OTU_4 2 1 1 0 0 1
## GG_OTU_5 0 1 1 0 0 0
## 5 x 6 sparse Matrix of class "dgCMatrix"
## Sample1 Sample2 Sample3 Sample4 Sample5 Sample6
## GG_OTU_1 . . 1 . . .
## GG_OTU_2 5 1 . 2 3 1
## GG_OTU_3 . . 1 4 . 2
## GG_OTU_4 2 1 1 . . 1
## GG_OTU_5 . 1 1 . . .
As you can see above, x1 and x2 are
represented in R by slightly different matrix classes, assigned
automatically based on the data. However, most operations in R will
understand this automatically and you should not have to worry about the
precise matrix class. However, if the R function you are attempting to
use is having a problem with these fancier classes, you can easily
coerce the data to the simple, standard "matrix" class
using the as function:
## Sample1 Sample2 Sample3 Sample4 Sample5 Sample6
## GG_OTU_1 0 0 1 0 0 0
## GG_OTU_2 5 1 0 2 3 1
## GG_OTU_3 0 0 1 4 0 2
## GG_OTU_4 2 1 1 0 0 1
## GG_OTU_5 0 1 1 0 0 0
Observation metadata is metadata associated with the individual units
being counted/recorded in a sample, as opposed to measurements of
properties of the samples themselves. For microbiome census data, for
instance, observation metadata is often a taxonomic classification and
anything else that might be known about a particular OTU/species. For
other types of data, it might be metadata known about a particular
genome, gene family, pathway, etc. In this case, the observations are
counts of OTUs and the metadata is taxonomic classification, if present.
The absence of observation metadata is also supported, as we see for the
minimal cases of x1 and x2, where we see
instead.
## NULL
## NULL
## taxonomy1 taxonomy2 taxonomy3
## GG_OTU_1 k__Bacteria p__Proteobacteria c__Gammaproteobacteria
## GG_OTU_2 k__Bacteria p__Cyanobacteria c__Nostocophycideae
## GG_OTU_3 k__Archaea p__Euryarchaeota c__Methanomicrobia
## GG_OTU_4 k__Bacteria p__Firmicutes c__Clostridia
## GG_OTU_5 k__Bacteria p__Proteobacteria c__Gammaproteobacteria
## taxonomy4 taxonomy5 taxonomy6
## GG_OTU_1 o__Enterobacteriales f__Enterobacteriaceae g__Escherichia
## GG_OTU_2 o__Nostocales f__Nostocaceae g__Dolichospermum
## GG_OTU_3 o__Methanosarcinales f__Methanosarcinaceae g__Methanosarcina
## GG_OTU_4 o__Halanaerobiales f__Halanaerobiaceae g__Halanaerobium
## GG_OTU_5 o__Enterobacteriales f__Enterobacteriaceae g__Escherichia
## taxonomy7
## GG_OTU_1 s__
## GG_OTU_2 s__
## GG_OTU_3 s__
## GG_OTU_4 s__Halanaerobiumsaccharolyticum
## GG_OTU_5 s__
## taxonomy1 taxonomy2 taxonomy3
## GG_OTU_1 k__Bacteria p__Proteobacteria c__Gammaproteobacteria
## GG_OTU_2 k__Bacteria p__Cyanobacteria c__Nostocophycideae
## [1] "data.frame"
Similarly, we can access metadata – if available – that describe
properties of the samples. We access this sample metadata using the
sample_metadata function.
## NULL
## NULL
## BarcodeSequence LinkerPrimerSequence BODY_SITE Description
## Sample1 CGCTTATCGAGA CATGCTGCCTCCCGTAGGAGT gut human gut
## Sample2 CATACCAGTAGC CATGCTGCCTCCCGTAGGAGT gut human gut
## Sample3 CTCTCTACCTGT CATGCTGCCTCCCGTAGGAGT gut human gut
## Sample4 CTCTCGGCCTGT CATGCTGCCTCCCGTAGGAGT skin human skin
## Sample5 CTCTCTACCAAT CATGCTGCCTCCCGTAGGAGT skin human skin
## Sample6 CTAACTACCAAT CATGCTGCCTCCCGTAGGAGT skin human skin
## BarcodeSequence LinkerPrimerSequence BODY_SITE
## Sample1 CGCTTATCGAGA CATGCTGCCTCCCGTAGGAGT gut
## Sample2 CATACCAGTAGC CATGCTGCCTCCCGTAGGAGT gut
## [1] "data.frame"
The biom objects in R can be written to a file/connection using the
write_biom function. If you modified the biom object, this
may still work as well, but no guarantees about this as we are still
working on internal checks. The following example writes x4
to a temporary file, then reads it back using read_biom and
stores it as variable y. The exact comparison of these two
objects using the identical function shows that they are
exactly the same in R.
## [1] FALSE
Furthermore, it is possible to invoke standard operating system
commands through the R system function – in this case to
invoke the diff command available on Unix-like systems or
the FC command on Windows – in order to compare the
original and temporary files directly. Note that this is shown here for
convenience, but not automatically run with the rest of the script
because of the OS-dependence. During development, though, this same
command is tested privately and no differences are reported between the
files.