%\VignetteEngine{knitr::knitr}
%\VignetteIndexEntry{2. Sequence Data Representations}
# Sequence Data Representations
Epigenomics 2014
Author: Martin Morgan (mtmorgan@fhcrc.org)
Date: 24 August, 2014
```{r setup, echo=FALSE}
knitr::opts_chunk$set(cache=TRUE)
```
## Bioconductor for sequence analysis
### DNA / amino acid sequences: FASTA files
Input & manipulation: [Biostrings][]
>NM_078863_up_2000_chr2L_16764737_f chr2L:16764737-16766736
gttggtggcccaccagtgccaaaatacacaagaagaagaaacagcatctt
gacactaaaatgcaaaaattgctttgcgtcaatgactcaaaacgaaaatg
...
atgggtatcaagttgccccgtataaaaggcaagtttaccggttgcacggt
>NM_001201794_up_2000_chr2L_8382455_f chr2L:8382455-8384454
ttatttatgtaggcgcccgttcccgcagccaaagcactcagaattccggg
cgtgtagcgcaacgaccatctacaaggcaatattttgatcgcttgttagg
...
### Reads: FASTQ files
Input & manipulation: [ShortRead][] `readFastq()`, `FastqStreamer()`,
`FastqSampler()`
@ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1
CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT
+
HHGHHGHHHHHHHHDGG>CE?=896=:
@ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1
GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC
+
DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?########################
- Quality scores: 'phred-like', encoded. See
[wikipedia](http://en.wikipedia.org/wiki/FASTQ_format#Encoding)
Example
```{r Biostrings, message=FALSE}
require(Biostrings) # Biological sequences
data(phiX174Phage) # sample data, see ?phiX174Phage
phiX174Phage
m <- consensusMatrix(phiX174Phage)[1:4,] # nucl. x position counts
polymorphic <- which(colSums(m != 0) > 1)
m[, polymorphic]
```
```{r showMethods, eval=FALSE}
showMethods(class=class(phiX174Phage), where=search())
```
### Case study: Working with DNA sequence data
1. Load the Biostrings package and phiX174Phage data set. What class
is phiX174Phage? Find the help page for the class, and identify
interesting functions that apply to it.
2. Discover vignettes in the Biostrings package with
`vignette(package="Biostrings")`. Add another argument to the
`vignette` function to view the 'BiostringsQuickOverview' vignette.
3. Navigate to the Biostrings landing page on
http://bioconductor.org. Do this by visiting the biocViews
page. Can you find the BiostringsQuickOverview vignette on the web
site?
4. The following code loads some sample data, 6 versions of the
phiX174Phage genome as a DNAStringSet object.
```{r phiX}
library(Biostrings)
data(phiX174Phage)
```
Explain what the following code does, and how it works
```{r consensusMatrix}
m <- consensusMatrix(phiX174Phage)[1:4,]
polymorphic <- which(colSums(m != 0) > 1)
mapply(substr, polymorphic, polymorphic, MoreArgs=list(x=phiX174Phage))
```
### Aligned reads: BAM files (e.g., ERR127306_chr14.bam)
Input & manipulation: 'low-level' [Rsamtools][], `scanBam()`,
`BamFile()`; 'high-level' [GenomicAlignments][]
- Header
@HD VN:1.0 SO:coordinate
@SQ SN:chr1 LN:249250621
@SQ SN:chr10 LN:135534747
@SQ SN:chr11 LN:135006516
...
@SQ SN:chrY LN:59373566
@PG ID:TopHat VN:2.0.8b CL:/home/hpages/tophat-2.0.8b.Linux_x86_64/tophat --mate-inner-dist 150 --solexa-quals --max-multihits 5 --no-discordant --no-mixed --coverage-search --microexon-search --library-type fr-unstranded --num-threads 2 --output-dir tophat2_out/ERR127306 /home/hpages/bowtie2-2.1.0/indexes/hg19 fastq/ERR127306_1.fastq fastq/ERR127306_2.fastq
- Alignments: ID, flag, alignment and mate
ERR127306.7941162 403 chr14 19653689 3 72M = 19652348 -1413 ...
ERR127306.22648137 145 chr14 19653692 1 72M = 19650044 -3720 ...
ERR127306.933914 339 chr14 19653707 1 66M120N6M = 19653686 -213 ...
ERR127306.11052450 83 chr14 19653707 3 66M120N6M = 19652348 -1551 ...
ERR127306.24611331 147 chr14 19653708 1 65M120N7M = 19653675 -225 ...
ERR127306.2698854 419 chr14 19653717 0 56M120N16M = 19653935 290 ...
ERR127306.2698854 163 chr14 19653717 0 56M120N16M = 19653935 2019 ...
- Alignments: sequence and quality
... GAATTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCC *'%%%%%#&&%''#'&%%%)&&%%$%%'%%'&*****$))$)'')'%)))&)%%%%$'%%%%&"))'')%))
... TTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAG '**)****)*'*&*********('&)****&***(**')))())%)))&)))*')&***********)****
... TGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCT '******&%)&)))&")')'')'*((******&)&'')'))$))'')&))$)**&&****************
... TGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCT ##&&(#')$')'%&&#)%$#$%"%###&!%))'%%''%'))&))#)&%((%())))%)%)))%*********
... GAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCTT )&$'$'$%!&&%&&#!'%'))%''&%'&))))''$""'%'%&%'#'%'"!'')#&)))))%$)%)&'"')))
... TTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCTTCATGTGGCT ++++++++++++++++++++++++++++++++++++++*++++++**++++**+**''**+*+*'*)))*)#
... TTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCTTCATGTGGCT ++++++++++++++++++++++++++++++++++++++*++++++**++++**+**''**+*+*'*)))*)#
- Alignments: Tags
... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:72 YT:Z:UU NH:i:2 CC:Z:chr22 CP:i:16189276 HI:i:0
... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:72 YT:Z:UU NH:i:3 CC:Z:= CP:i:19921600 HI:i:0
... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:4 MD:Z:72 YT:Z:UU XS:A:+ NH:i:3 CC:Z:= CP:i:19921465 HI:i:0
... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:4 MD:Z:72 YT:Z:UU XS:A:+ NH:i:2 CC:Z:chr22 CP:i:16189138 HI:i:0
... AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:5 MD:Z:72 YT:Z:UU XS:A:+ NH:i:3 CC:Z:= CP:i:19921464 HI:i:0
... AS:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:72 NM:i:0 XS:A:+ NH:i:5 CC:Z:= CP:i:19653717 HI:i:0
... AS:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:72 NM:i:0 XS:A:+ NH:i:5 CC:Z:= CP:i:19921455 HI:i:1
### Called variants: VCF files
Input and manipulation: [VariantAnnotation][] `readVcf()`,
`readInfo()`, `readGeno()` selectively with `ScanVcfParam()`.
- Header
##fileformat=VCFv4.2
##fileDate=20090805
##source=myImputationProgramV3.1
##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta
##contig=
##phasing=partial
##INFO=
##INFO=
...
##FILTER=
##FILTER=
...
##FORMAT=
##FORMAT=
- Location
#CHROM POS ID REF ALT QUAL FILTER ...
20 14370 rs6054257 G A 29 PASS ...
20 17330 . T A 3 q10 ...
20 1110696 rs6040355 A G,T 67 PASS ...
20 1230237 . T . 47 PASS ...
20 1234567 microsat1 GTC G,GTCT 50 PASS ...
- Variant INFO
#CHROM POS ... INFO ...
20 14370 ... NS=3;DP=14;AF=0.5;DB;H2 ...
20 17330 ... NS=3;DP=11;AF=0.017 ...
20 1110696 ... NS=2;DP=10;AF=0.333,0.667;AA=T;DB ...
20 1230237 ... NS=3;DP=13;AA=T ...
20 1234567 ... NS=3;DP=9;AA=G ...
- Genotype FORMAT and samples
... POS ... FORMAT NA00001 NA00002 NA00003
... 14370 ... GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,.
... 17330 ... GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3
... 1110696 ... GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4
... 1230237 ... GT:GQ:DP:HQ 0|0:54:7:56,60 0|0:48:4:51,51 0/0:61:2
... 1234567 ... GT:GQ:DP 0/1:35:4 0/2:17:2 1/1:40:3
### Genome annotations: BED, WIG, GTF, etc. files
Input: [rtracklayer][] `import()`
- BED: range-based annotation (see
http://genome.ucsc.edu/FAQ/FAQformat.html for definition of this and
related formats)
- WIG / bigWig: dense, continuous-valued data
- GTF: gene model
- Component coordinates
7 protein_coding gene 27221129 27224842 . - . ...
...
7 protein_coding transcript 27221134 27224835 . - . ...
7 protein_coding exon 27224055 27224835 . - . ...
7 protein_coding CDS 27224055 27224763 . - 0 ...
7 protein_coding start_codon 27224761 27224763 . - 0 ...
7 protein_coding exon 27221134 27222647 . - . ...
7 protein_coding CDS 27222418 27222647 . - 2 ...
7 protein_coding stop_codon 27222415 27222417 . - 0 ...
7 protein_coding UTR 27224764 27224835 . - . ...
7 protein_coding UTR 27221134 27222414 . - . ...
- Annotations
gene_id "ENSG00000005073"; gene_name "HOXA11"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...
... transcript_id "ENST00000006015"; transcript_name "HOXA11-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS5411";
... exon_number "1"; exon_id "ENSE00001147062";
... exon_number "1"; protein_id "ENSP00000006015";
... exon_number "1";
... exon_number "2"; exon_id "ENSE00002099557";
... exon_number "2"; protein_id "ENSP00000006015";
... exon_number "2";
...
## Data representation
### Ranges
Ranges represent:
- Data, e.g., aligned reads, ChIP peaks, SNPs, CpG islands, ...
- Annotations, e.g., gene models, regulatory elements, methylated
regions
- Ranges are defined by chromosome, start, end, and strand
- Often, metadata is associated with each range, e.g., quality of
alignment, strength of ChIP peak
Many common biological questions are range-based
- What reads overlap genes?
- What genes are ChIP peaks nearest?
- ...
The [GenomicRanges][] package defines essential classes and methods
- `GRanges`
- `GRangesList`
### Range operations
Ranges
- IRanges
- `start()` / `end()` / `width()`
- List-like -- `length()`, subset, etc.
- 'metadata', `mcols()`
- GRanges
- 'seqnames' (chromosome), 'strand'
- `Seqinfo`, including `seqlevels` and `seqlengths`
Intra-range methods
- Independent of other ranges in the same object
- GRanges variants strand-aware
- `shift()`, `narrow()`, `flank()`, `promoters()`, `resize()`,
`restrict()`, `trim()`
- See `?"intra-range-methods"`
Inter-range methods
- Depends on other ranges in the same object
- `range()`, `reduce()`, `gaps()`, `disjoin()`
- `coverage()` (!)
- see `?"inter-range-methods"`
Between-range methods
- Functions of two (or more) range objects
- `findOverlaps()`, `countOverlaps()`, ..., `%over%`, `%within%`,
`%outside%`; `union()`, `intersect()`, `setdiff()`, `punion()`,
`pintersect()`, `psetdiff()`
Example
```{r ranges, message=FALSE}
require(GenomicRanges)
gr <- GRanges("A", IRanges(c(10, 20, 22), width=5), "+")
shift(gr, 1) # 1-based coordinates!
range(gr) # intra-range
reduce(gr) # inter-range
coverage(gr)
setdiff(range(gr), gr) # 'introns'
```
IRangesList, GRangesList
- List: all elements of the same type
- Many *List-aware methods, but a common 'trick': apply a vectorized
function to the unlisted representaion, then re-list
grl <- GRangesList(...)
orig_gr <- unlist(grl)
transformed_gr <- FUN(orig)
transformed_grl <- relist(, grl)
Reference
- Lawrence M, Huber W, Pagès H, Aboyoun P, Carlson M, et al. (2013)
Software for Computing and Annotating Genomic Ranges. PLoS Comput
Biol 9(8): e1003118. doi:10.1371/journal.pcbi.1003118
### [Biostrings][] (DNA or amino acid sequences)
Classes
- XString, XStringSet, e.g., DNAString (genomes),
DNAStringSet (reads)
Methods --
- [Cheat sheat](http://bioconductor.org/packages/release/bioc/vignettes/Biostrings/inst/doc/BiostringsQuickOverview.pdf)
- Manipulation, e.g., `reverseComplement()`
- Summary, e.g., `letterFrequency()`
- Matching, e.g., `matchPDict()`, `matchPWM()`
Related packages
- [BSgenome][]
- Whole-genome representations
- Model and custom
- [ShortRead][]
- FASTQ files
Example
- Whole-genome sequences are distrubuted by ENSEMBL, NCBI, and others
as FASTA files; model organism whole genome sequences are packaged
into more user-friendly `BSgenome` packages. The following
calculates GC content across chr14.
```{r BSgenome-require, message=FALSE}
require(BSgenome.Hsapiens.UCSC.hg19)
chr14_range = GRanges("chr14", IRanges(1, seqlengths(Hsapiens)["chr14"]))
chr14_dna <- getSeq(Hsapiens, chr14_range)
letterFrequency(chr14_dna, "GC", as.prob=TRUE)
```
### [GenomicAlignments][] (Aligned reads)
Classes -- GenomicRanges-like behaivor
- GAlignments, GAlignmentPairs, GAlignmentsList
- SummarizedExperiment
- Matrix where rows are indexed by genomic ranges, columns by a
DataFrame.
Methods
- `readGAlignments()`, `readGAlignmentsList()`
- Easy to restrict input, iterate in chunks
- `summarizeOverlaps()`
Example
- Find reads supporting the junction identified above, at position
19653707 + 66M = 19653773 of chromosome 14
```{r bam-require}
require(GenomicRanges)
require(GenomicAlignments)
require(Rsamtools)
## our 'region of interest'
roi <- GRanges("chr14", IRanges(19653773, width=1))
## sample data
require('RNAseqData.HNRNPC.bam.chr14')
bf <- BamFile(RNAseqData.HNRNPC.bam.chr14_BAMFILES[[1]], asMates=TRUE)
## alignments, junctions, overlapping our roi
paln <- readGAlignmentsList(bf)
j <- summarizeJunctions(paln, with.revmap=TRUE)
j_overlap <- j[j %over% roi]
## supporting reads
paln[j_overlap$revmap[[1]]]
```
### [VariantAnnotation][] (Called variants)
Classes -- GenomicRanges-like behavior
- VCF -- 'wide'
- VRanges -- 'tall'
Functions and methods
- I/O and filtering: `readVcf()`, `readGeno()`, `readInfo()`,
`readGT()`, `writeVcf()`, `filterVcf()`
- Annotation: `locateVariants()` (variants overlapping ranges),
`predictCoding()`, `summarizeVariants()`
- SNPs: `genotypeToSnpMatrix()`, `snpSummary()`
Example
- Read variants from a VCF file, and annotate with respect to a known
gene model
```{r vcf, message=FALSE}
## input variants
require(VariantAnnotation)
fl <- system.file("extdata", "chr22.vcf.gz", package="VariantAnnotation")
vcf <- readVcf(fl, "hg19")
seqlevels(vcf) <- "chr22"
## known gene model
require(TxDb.Hsapiens.UCSC.hg19.knownGene)
coding <- locateVariants(rowData(vcf),
TxDb.Hsapiens.UCSC.hg19.knownGene,
CodingVariants())
head(coding)
```
Related packages
- [ensemblVEP][]
- Forward variants to Ensembl Variant Effect Predictor
- [VariantTools][], [h5vc][]
- Call variants
Reference
- Obenchain, V, Lawrence, M, Carey, V, Gogarten, S, Shannon, P, and
Morgan, M. VariantAnnotation: a Bioconductor package for exploration
and annotation of genetic variants. Bioinformatics, first published
online March 28, 2014
[doi:10.1093/bioinformatics/btu168](http://bioinformatics.oxfordjournals.org/content/early/2014/04/21/bioinformatics.btu168)
### [rtracklayer][] (Genome annotations)
- Import BED, GTF, WIG, etc
- Export GRanges to BED, GTF, WIG, ...
- Access UCSC genome browser
## Big data
Restriction
- e.g., `ScanBamParam()` limits input to desired data at specific
genomic ranges
Iteration
- e.g., `yieldSize` argument of `BamFile()`, or `FastqStreamer()`
allows iteration through large files.
Compression
- Genomic vectors represented as `Rle` (run-length encoding) class
- Lists e.g., `GRangesList` are efficiently maintain the illusion that
vector elements are grouped.
Parallel processing
- e.g., via [BiocParallel][] package
Reference
- Lawrence, M and Morgan, M. Scalable Genomic Computing and
Visualization with R/Bioconductor. Statistical Science
[forthcoming](http://www.e-publications.org/ims/submission/STS/user/submissionFile/16331?confirm=d92def1e)
## Exercises
### Summarize overlaps
The goal is to count the number of reads overlapping exons grouped
into genes. This type of count data is the basic input for RNASeq
differential expression analysis, e.g., through [DESeq2][] and
[edgeR][].
1. Identify the regions of interest. We use a 'TxDb' package with gene
models alreaddy defined
```{r summarizeOverlaps-roi, message=FALSE}
require(TxDb.Hsapiens.UCSC.hg19.knownGene)
exByGn <- exonsBy(TxDb.Hsapiens.UCSC.hg19.knownGene, "gene")
## only chromosome 14
seqlevels(exByGn, force=TRUE) = "chr14"
```
2. Identify the sample BAM files.
```{r summarizeOverlaps-bam, message=FALSE}
require(RNAseqData.HNRNPC.bam.chr14)
length(RNAseqData.HNRNPC.bam.chr14_BAMFILES)
```
3. Summarize overlaps, optionally in parallel
```{r summarizeOverlaps}
## next 2 lines optional; non-Windows
library(BiocParallel)
register(MulticoreParam(workers=detectCores()))
olaps <- summarizeOverlaps(exByGn, RNAseqData.HNRNPC.bam.chr14_BAMFILES)
```
4. Explore our handiwork, e.g., library sizes (column sums),
relationship between gene length and number of mapped reads, etc.
```{r summarizeOverlaps-explore}
olaps
head(assay(olaps))
colSums(assay(olaps)) # library sizes
plot(sum(width(olaps)), rowMeans(assay(olaps)), log="xy")
```
5. As an advanced exercise, investigate the relationship between GC
content and read count
```{r summarizeOverlaps-gc}
require(BSgenome.Hsapiens.UCSC.hg19)
sequences <- getSeq(BSgenome.Hsapiens.UCSC.hg19, rowData(olaps))
gcPerExon <- letterFrequency(unlist(sequences), "GC")
gc <- relist(as.vector(gcPerExon), sequences)
gc_percent <- sum(gc) / sum(width(olaps))
plot(gc_percent, rowMeans(assay(olaps)), log="y")
```
[BSgenome]: http://bioconductor.org/packages/release/bioc/html/BSgenome.html
[BiocParallel]: http://bioconductor.org/packages/release/bioc/html/BiocParallel.html
[Biostrings]: http://bioconductor.org/packages/release/bioc/html/Biostrings.html
[DESeq2]: http://bioconductor.org/packages/release/bioc/html/DESeq2.html
[GenomicRanges]: http://bioconductor.org/packages/release/bioc/html/GenomicRanges.html
[GenomicAlignments]: http://bioconductor.org/packages/release/bioc/html/GenomicAlignments.html
[Rsamtools]: http://bioconductor.org/packages/release/bioc/html/Rsamtools.html
[ShortRead]: http://bioconductor.org/packages/release/bioc/html/ShortRead.html
[VariantAnnotation]: http://bioconductor.org/packages/release/bioc/html/VariantAnnotation.html
[VariantTools]: http://bioconductor.org/packages/release/bioc/html/VariantTools.html
[edgeR]: http://bioconductor.org/packages/release/bioc/html/edgeR.html
[ensemblVEP]: http://bioconductor.org/packages/release/bioc/html/ensemblVEP.html
[h5vc]: http://bioconductor.org/packages/release/bioc/html/h5vc.html
[rtracklayer]: http://bioconductor.org/packages/release/bioc/html/rtracklayer.html